Transcript: Human NM_001322026.2

Homo sapiens G-patch domain containing 2 like (GPATCH2L), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GPATCH2L (55668)
Length:
3263
CDS:
81..1385

Additional Resources:

NCBI RefSeq record:
NM_001322026.2
NBCI Gene record:
GPATCH2L (55668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137446 GCCATTGTCAAGAGTAAGCAA pLKO.1 384 CDS 100% 3.000 4.200 N GPATCH2L n/a
2 TRCN0000413589 GGATTCTGGATTGGATAAATT pLKO_005 920 CDS 100% 15.000 10.500 N GPATCH2L n/a
3 TRCN0000137175 GCAGACATCTGAGCAGAATAA pLKO.1 119 CDS 100% 13.200 9.240 N GPATCH2L n/a
4 TRCN0000425521 TAAAGCGTTGGCTTCTGATTT pLKO_005 1235 CDS 100% 13.200 9.240 N GPATCH2L n/a
5 TRCN0000425770 GGCATGAATCTGACTCCTTTA pLKO_005 412 CDS 100% 10.800 7.560 N GPATCH2L n/a
6 TRCN0000133974 CCTGATCATTGTTCTGAAGTA pLKO.1 891 CDS 100% 4.950 3.465 N GPATCH2L n/a
7 TRCN0000134414 GAGTGTGAAACAGATGAACAA pLKO.1 690 CDS 100% 4.950 3.465 N GPATCH2L n/a
8 TRCN0000137212 GATGACACAATGGTAGCCAAA pLKO.1 345 CDS 100% 4.050 2.835 N GPATCH2L n/a
9 TRCN0000137270 CAGGTTCAAGTCTGCTAAGAA pLKO.1 554 CDS 100% 5.625 3.375 N GPATCH2L n/a
10 TRCN0000138496 CAGAAGCTGAAGGTGTCAGAT pLKO.1 513 CDS 100% 4.950 2.970 N GPATCH2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12245 pDONR223 100% 79.2% 74.7% None (many diffs) n/a
2 ccsbBroad304_12245 pLX_304 0% 79.2% 74.7% V5 (many diffs) n/a
3 TRCN0000479474 ACTTCGACCGCAATTTACCACCCC pLX_317 29.4% 79.2% 74.7% V5 (many diffs) n/a
Download CSV