Transcript: Human NM_001322048.1

Homo sapiens FAST kinase domains 1 (FASTKD1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
FASTKD1 (79675)
Length:
4202
CDS:
393..2867

Additional Resources:

NCBI RefSeq record:
NM_001322048.1
NBCI Gene record:
FASTKD1 (79675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129813 CCGCTTCTGTCAACAATATAA pLKO.1 2372 CDS 100% 15.000 21.000 N FASTKD1 n/a
2 TRCN0000352895 TCCGTATGGAAGCCATAATAT pLKO_005 2549 CDS 100% 15.000 21.000 N FASTKD1 n/a
3 TRCN0000380103 ACTTGCGTGCAACATCTTAAT pLKO_005 2109 CDS 100% 13.200 18.480 N FASTKD1 n/a
4 TRCN0000343803 TCGGTTCTTACGCCTTATTAC pLKO_005 2481 CDS 100% 13.200 18.480 N FASTKD1 n/a
5 TRCN0000128611 CTCAGTACTTTGCTACTAGAT pLKO.1 1968 CDS 100% 4.950 6.930 N FASTKD1 n/a
6 TRCN0000343746 CTGTTCTGGTCCGTGCTATTT pLKO_005 1573 CDS 100% 13.200 9.240 N FASTKD1 n/a
7 TRCN0000381302 GACCGCTTCTGTCAACAATAT pLKO_005 2370 CDS 100% 13.200 9.240 N FASTKD1 n/a
8 TRCN0000343804 GGGAATCAAATATCGAAATAG pLKO_005 2599 CDS 100% 13.200 9.240 N FASTKD1 n/a
9 TRCN0000343745 ATTCGTCCATTCAGCGTATTG pLKO_005 2052 CDS 100% 10.800 7.560 N FASTKD1 n/a
10 TRCN0000128653 CTAGCAGATCAGCATTTGTAT pLKO.1 807 CDS 100% 5.625 3.938 N FASTKD1 n/a
11 TRCN0000129716 CCAGTTTGAATGGAACTCTAT pLKO.1 2771 CDS 100% 4.950 3.465 N FASTKD1 n/a
12 TRCN0000130191 CTTGTCTGTCTTGATGGTCAA pLKO.1 899 CDS 100% 4.050 2.835 N FASTKD1 n/a
13 TRCN0000380067 AGGTACTAGGAGGAATCAATT pLKO_005 2449 CDS 100% 13.200 7.920 N FASTKD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12590 pDONR223 100% 81.8% 81.9% None 1_447del;1608A>G n/a
2 ccsbBroadEn_15150 pDONR223 0% 81.8% 81.9% None 1_447del;1608A>G n/a
3 ccsbBroad304_15150 pLX_304 0% 81.8% 81.9% V5 1_447del;1608A>G n/a
4 TRCN0000466392 CCCCACCTGTCGTCTGTACTGGGC pLX_317 16.1% 81.8% 81.9% V5 1_447del;1608A>G n/a
Download CSV