Transcript: Human NM_001322209.2

Homo sapiens 5-hydroxytryptamine receptor 1F (HTR1F), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
HTR1F (3355)
Length:
3386
CDS:
297..1397

Additional Resources:

NCBI RefSeq record:
NM_001322209.2
NBCI Gene record:
HTR1F (3355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009091 CCCTTCAGCATTGTGTATATT pLKO.1 528 CDS 100% 15.000 10.500 N HTR1F n/a
2 TRCN0000357491 GTATCTCAATTCCCTTATAAA pLKO_005 1304 CDS 100% 15.000 10.500 N HTR1F n/a
3 TRCN0000009088 CCACATTGTTTCCACCATTTA pLKO.1 827 CDS 100% 13.200 9.240 N HTR1F n/a
4 TRCN0000357490 GCTAAATTGATAAGGCTATAA pLKO_005 1507 3UTR 100% 13.200 9.240 N HTR1F n/a
5 TRCN0000357442 TTGTGATCGCTGCAATTATTG pLKO_005 424 CDS 100% 13.200 9.240 N HTR1F n/a
6 TRCN0000009090 GTTGTTAATGTCTGTGACAAA pLKO.1 1239 CDS 100% 4.950 3.465 N HTR1F n/a
7 TRCN0000009089 GCACTAAATCAGTTTCCACAT pLKO.1 1006 CDS 100% 4.050 2.835 N HTR1F n/a
8 TRCN0000009092 CCATCAACAGACTTTGATAAA pLKO.1 1056 CDS 100% 1.320 0.792 N HTR1F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489611 TGCCGATGATATCCATACTTCAGC pLX_317 24.8% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489793 CGTGGTTAGAGCTGTGTCAAACCG pLX_317 38% 99.9% 99.7% V5 1098_1099insG n/a
Download CSV