Transcript: Human NM_001322257.1

Homo sapiens RAD54 like 2 (RAD54L2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RAD54L2 (23132)
Length:
9849
CDS:
1423..4593

Additional Resources:

NCBI RefSeq record:
NM_001322257.1
NBCI Gene record:
RAD54L2 (23132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322257.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245584 GCCCATCGTATGCGCAGTATT pLKO_005 3140 CDS 100% 13.200 18.480 N RAD54L2 n/a
2 TRCN0000245585 TTGCCATTGTGCCGGTTAATA pLKO_005 1111 5UTR 100% 15.000 12.000 N RAD54L2 n/a
3 TRCN0000245586 TCGGGTGGTGGATGATCTAAA pLKO_005 2847 CDS 100% 13.200 10.560 N RAD54L2 n/a
4 TRCN0000245583 CAAGGACCTTCTGACTAATTA pLKO_005 2310 CDS 100% 15.000 10.500 N RAD54L2 n/a
5 TRCN0000245587 TTGAGAGGGAGCGGCTTATTA pLKO_005 2564 CDS 100% 15.000 10.500 N RAD54L2 n/a
6 TRCN0000150049 CCAAGTTTCCTTGAACGTAAA pLKO.1 2937 CDS 100% 10.800 7.560 N RAD54L2 n/a
7 TRCN0000179414 CCCAAGTTTCCTTGAACGTAA pLKO.1 2936 CDS 100% 4.950 3.465 N RAD54L2 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 8559 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 8357 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322257.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11682 pDONR223 100% 74.3% 75.2% None 0_1ins982;32_110del;1123_1124insGGCTAG n/a
2 ccsbBroad304_11682 pLX_304 0% 74.3% 75.2% V5 0_1ins982;32_110del;1123_1124insGGCTAG n/a
3 TRCN0000466692 TATTCTTCGGCCATCACAATACAC pLX_317 7.5% 74.3% 75.2% V5 0_1ins982;32_110del;1123_1124insGGCTAG n/a
Download CSV