Transcript: Human NM_001322324.2

Homo sapiens Ral GEF with PH domain and SH3 binding motif 1 (RALGPS1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RALGPS1 (9649)
Length:
6238
CDS:
297..1841

Additional Resources:

NCBI RefSeq record:
NM_001322324.2
NBCI Gene record:
RALGPS1 (9649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373356 GGCCTTTACCCGGAGGTTTAA pLKO_005 572 CDS 100% 13.200 18.480 N RALGPS1 n/a
2 TRCN0000153515 CGTTGTCTTCGATGTCTTGAA pLKO.1 419 CDS 100% 4.950 6.930 N RALGPS1 n/a
3 TRCN0000153713 CCCGATTTCATGCAATACTGT pLKO.1 1747 CDS 100% 3.000 4.200 N RALGPS1 n/a
4 TRCN0000155372 CGACAACTACAAACTGTCGCT pLKO.1 1127 CDS 100% 0.066 0.092 N RALGPS1 n/a
5 TRCN0000373314 CAAGCGGACACGGGAATATAT pLKO_005 848 CDS 100% 15.000 10.500 N RALGPS1 n/a
6 TRCN0000373355 TGCTAGCCAGATTACATTAAT pLKO_005 458 CDS 100% 15.000 10.500 N RALGPS1 n/a
7 TRCN0000152217 CTGTGGTATCAGCATTACAAA pLKO.1 724 CDS 100% 5.625 3.938 N RALGPS1 n/a
8 TRCN0000154659 GCAAGCAACATCTGCTCTGTT pLKO.1 4930 3UTR 100% 4.950 3.465 N RALGPS1 n/a
9 TRCN0000154931 GCTGTCTACAACTGTGGAGTT pLKO.1 4489 3UTR 100% 4.050 2.835 N RALGPS1 n/a
10 TRCN0000154173 CTATAAATCCACACCTGGCAA pLKO.1 1613 CDS 100% 2.640 1.848 N RALGPS1 n/a
11 TRCN0000150739 GCATTTGGATGATGCATGTAA pLKO.1 1775 CDS 100% 5.625 3.375 N RALGPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.