Transcript: Human NM_001322872.2

Homo sapiens SATB homeobox 1 (SATB1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SATB1 (6304)
Length:
6370
CDS:
286..2577

Additional Resources:

NCBI RefSeq record:
NM_001322872.2
NBCI Gene record:
SATB1 (6304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229676 GGTCGATGTGGCAGAATATAA pLKO_005 2424 CDS 100% 15.000 21.000 N SATB1 n/a
2 TRCN0000229674 GGAATCTCCCAGGCGGTATTT pLKO_005 1444 CDS 100% 13.200 18.480 N SATB1 n/a
3 TRCN0000218667 TCCATTGTGAACAGTACTTAC pLKO_005 937 CDS 100% 10.800 15.120 N SATB1 n/a
4 TRCN0000017173 GCTCTATGTTATCCAAGCAAT pLKO.1 3436 3UTR 100% 4.950 3.960 N SATB1 n/a
5 TRCN0000229675 AGCTGAAAGAGACCGAATATA pLKO_005 1596 CDS 100% 15.000 10.500 N SATB1 n/a
6 TRCN0000229677 CAAGGATTGTTTGGTATTAAA pLKO_005 2794 3UTR 100% 15.000 10.500 N SATB1 n/a
7 TRCN0000017176 GCAGTCCTTAAACCAACAATA pLKO.1 1302 CDS 100% 13.200 9.240 N SATB1 n/a
8 TRCN0000017177 CCTTCCCAAGTACACCATCAT pLKO.1 2334 CDS 100% 4.950 3.465 N SATB1 n/a
9 TRCN0000017174 GCTTCCATTTATGATGAGATT pLKO.1 1771 CDS 100% 4.950 3.465 N SATB1 n/a
10 TRCN0000017175 CCACTGTCTTACGTGACAGAT pLKO.1 706 CDS 100% 0.495 0.347 N SATB1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5149 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01484 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01484 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474374 AAACCATCTCCGACATGAATGTTA pLX_317 24.6% 100% 100% V5 n/a
Download CSV