Transcript: Human NM_001323603.1

Homo sapiens taspase 1 (TASP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TASP1 (55617)
Length:
2635
CDS:
691..1647

Additional Resources:

NCBI RefSeq record:
NM_001323603.1
NBCI Gene record:
TASP1 (55617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032342 CGCACCATACTGGCTAGAGAA pLKO.1 1279 CDS 100% 4.950 6.930 N Tasp1 n/a
2 TRCN0000005965 GCACCATACTGGCTAGAGAAT pLKO.1 1280 CDS 100% 4.950 6.930 N TASP1 n/a
3 TRCN0000425987 AGGAATGGGATCTAATCTAAA pLKO_005 687 5UTR 100% 13.200 10.560 N TASP1 n/a
4 TRCN0000005964 CGAGCTTGTCAGAAGGCAATT pLKO.1 316 5UTR 100% 10.800 8.640 N TASP1 n/a
5 TRCN0000005963 CCTCATTGTGTGACCAGGAAT pLKO.1 1925 3UTR 100% 4.950 3.960 N TASP1 n/a
6 TRCN0000421536 GAAACAAAGCAGTCCTATAAA pLKO_005 208 5UTR 100% 15.000 10.500 N TASP1 n/a
7 TRCN0000420877 CAACTGTCGCTGATGTGATAT pLKO_005 2037 3UTR 100% 13.200 9.240 N TASP1 n/a
8 TRCN0000005966 CGGTTGCCAACAGACTCTTAT pLKO.1 806 CDS 100% 13.200 9.240 N TASP1 n/a
9 TRCN0000432143 GAAGCGTCTCAGAGGCATTTC pLKO_005 1665 3UTR 100% 10.800 7.560 N TASP1 n/a
10 TRCN0000415046 TCTCAGGTTTCGGCTGGTAAA pLKO_005 169 5UTR 100% 10.800 7.560 N TASP1 n/a
11 TRCN0000425319 TGCATGCAGGTGCAGGTTATC pLKO_005 254 5UTR 100% 10.800 7.560 N TASP1 n/a
12 TRCN0000005967 CAAGTTTATCAGTTCACCTTT pLKO.1 1359 CDS 100% 4.950 3.465 N TASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487713 TCCGCTATTGTCCTTTTATGTTTA pLX_317 18.6% 75.7% 75.7% V5 (not translated due to prior stop codon) 0_1ins306 n/a
2 TRCN0000489233 CCTGGCGAGCATCCCAATCAAGTT pLX_317 28.7% 75.6% 75.5% V5 0_1ins306;954_955insG n/a
Download CSV