Transcript: Human NM_001323943.2

Homo sapiens DIS3 like exosome 3'-5' exoribonuclease (DIS3L), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DIS3L (115752)
Length:
3802
CDS:
1162..3216

Additional Resources:

NCBI RefSeq record:
NM_001323943.2
NBCI Gene record:
DIS3L (115752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153834 CTGGGTAGCTATTTCGCATAT pLKO.1 3317 3UTR 100% 10.800 15.120 N DIS3L n/a
2 TRCN0000315359 CTGGGTAGCTATTTCGCATAT pLKO_005 3317 3UTR 100% 10.800 15.120 N DIS3L n/a
3 TRCN0000350506 GAACAAGGGCCACCACTTATT pLKO_005 1619 CDS 100% 13.200 10.560 N DIS3L n/a
4 TRCN0000150758 GAGCTGTCATATGTGAATGTT pLKO.1 3236 3UTR 100% 0.000 0.000 N DIS3L n/a
5 TRCN0000350507 GCATATCTGACGGAGTTATTT pLKO_005 2672 CDS 100% 15.000 10.500 N DIS3L n/a
6 TRCN0000315302 TGGTATGGCAGAACCATTATT pLKO_005 1777 CDS 100% 15.000 10.500 N DIS3L n/a
7 TRCN0000151790 CCCACTTTACTTCTCCAATAA pLKO.1 2429 CDS 100% 13.200 9.240 N DIS3L n/a
8 TRCN0000315360 ACGCAGCTGTTTGGTACTATC pLKO_005 655 5UTR 100% 10.800 7.560 N DIS3L n/a
9 TRCN0000153835 CCACGAGCTTTGTGATTCTAT pLKO.1 818 5UTR 100% 5.625 3.938 N DIS3L n/a
10 TRCN0000152818 GCATATACAACGCAGCTGTTT pLKO.1 646 5UTR 100% 4.950 3.465 N DIS3L n/a
11 TRCN0000152538 GCGTCATGATTGCATTCTCTT pLKO.1 551 5UTR 100% 4.950 3.465 N DIS3L n/a
12 TRCN0000152988 GAGTTCCATCATTACGGTCTT pLKO.1 2392 CDS 100% 4.050 2.835 N DIS3L n/a
13 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 3427 3UTR 100% 4.050 2.025 Y LOC441087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09421 pDONR223 100% 70.4% 69.3% None 0_1ins691;51_52ins170;111T>C n/a
2 ccsbBroad304_09421 pLX_304 0% 70.4% 69.3% V5 0_1ins691;51_52ins170;111T>C n/a
3 TRCN0000479100 TCCCGTAAGACTGGGTCGTATCCT pLX_317 13.5% 70.4% 69.3% V5 0_1ins691;51_52ins170;111T>C n/a
Download CSV