Transcript: Human NM_001324085.1

Homo sapiens zinc finger protein 75a (ZNF75A), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
ZNF75A (7627)
Length:
2368
CDS:
286..987

Additional Resources:

NCBI RefSeq record:
NM_001324085.1
NBCI Gene record:
ZNF75A (7627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020247 CAACAGTGTGATAAGAGGTTT pLKO.1 1344 3UTR 100% 4.950 6.930 N ZNF75A n/a
2 TRCN0000418857 TCACTTGAGTTCCTTCTTAAA pLKO_005 2103 3UTR 100% 13.200 10.560 N ZNF75A n/a
3 TRCN0000020246 CAGCCATATACTTGTAGCATA pLKO.1 1581 3UTR 100% 4.950 3.960 N ZNF75A n/a
4 TRCN0000430002 CAGTAGCAGGCTTACCAATTT pLKO_005 1979 3UTR 100% 13.200 9.240 N ZNF75A n/a
5 TRCN0000020244 CCTGTGTCTCTTTCTGACTTA pLKO.1 1017 3UTR 100% 4.950 3.465 N ZNF75A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13749 pDONR223 100% 64.1% 58.1% None (many diffs) n/a
2 ccsbBroad304_13749 pLX_304 0% 64.1% 58.1% V5 (many diffs) n/a
3 TRCN0000466382 ACTACCCGATGGAAACATAATCTC pLX_317 19.4% 64.1% 58.1% V5 (many diffs) n/a
Download CSV