Transcript: Human NM_001324112.2

Homo sapiens cytochrome P450 family 7 subfamily B member 1 (CYP7B1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
CYP7B1 (9420)
Length:
2651
CDS:
151..1533

Additional Resources:

NCBI RefSeq record:
NM_001324112.2
NBCI Gene record:
CYP7B1 (9420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064540 GCGTGACGAAATTGACCGTTT pLKO.1 1104 CDS 100% 4.050 5.670 N CYP7B1 n/a
2 TRCN0000434967 CAATTAAGCTTTCGAGTATTT pLKO_005 472 CDS 100% 13.200 10.560 N CYP7B1 n/a
3 TRCN0000064541 GCAAGGCAAATCTTTGGACAT pLKO.1 585 CDS 100% 4.050 3.240 N CYP7B1 n/a
4 TRCN0000064539 CCACCTCACCAGAGAACAATT pLKO.1 1167 CDS 100% 13.200 9.240 N CYP7B1 n/a
5 TRCN0000064538 CCCATTGAGCTTCTAGGAAAT pLKO.1 841 CDS 100% 10.800 7.560 N CYP7B1 n/a
6 TRCN0000064542 TGGTGGAAAGTACATAACATT pLKO.1 405 CDS 100% 5.625 3.938 N CYP7B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02161 pDONR223 100% 87% 80.5% None (many diffs) n/a
2 ccsbBroad304_02161 pLX_304 0% 87% 80.5% V5 (many diffs) n/a
3 TRCN0000477059 CGTTTCAGCCGAGCTCTCATTCCT pLX_317 21.9% 87% 80.5% V5 (many diffs) n/a
Download CSV