Transcript: Human NM_001324135.2

Homo sapiens X-prolyl aminopeptidase 1 (XPNPEP1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
XPNPEP1 (7511)
Length:
2446
CDS:
79..2028

Additional Resources:

NCBI RefSeq record:
NM_001324135.2
NBCI Gene record:
XPNPEP1 (7511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222570 CCTCTAACATTGGTTCCAATT pLKO.1 1837 CDS 100% 10.800 15.120 N XPNPEP1 n/a
2 TRCN0000073927 CCCGTTCAGCTTTATGGGATT pLKO.1 1571 CDS 100% 4.050 5.670 N XPNPEP1 n/a
3 TRCN0000413802 GCTCATCAGAGTGAGTATATT pLKO_005 316 CDS 100% 15.000 10.500 N XPNPEP1 n/a
4 TRCN0000073923 GTTGAGAACAAGCCAAGAATA pLKO.1 2226 3UTR 100% 13.200 9.240 N XPNPEP1 n/a
5 TRCN0000441033 ACAGATGTGACGCGGACAATG pLKO_005 1429 CDS 100% 10.800 7.560 N XPNPEP1 n/a
6 TRCN0000428268 AGACGATCATGCTCTTCATTG pLKO_005 899 CDS 100% 10.800 7.560 N XPNPEP1 n/a
7 TRCN0000073926 CCCTTGATCATTCCTACAGAT pLKO.1 568 CDS 100% 4.950 3.465 N XPNPEP1 n/a
8 TRCN0000031936 GCCTGACCTTTGAACCTCTAA pLKO.1 1823 CDS 100% 4.950 3.465 N Xpnpep1 n/a
9 TRCN0000324857 GCCTGACCTTTGAACCTCTAA pLKO_005 1823 CDS 100% 4.950 3.465 N Xpnpep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11222 pDONR223 100% 90.9% 90.9% None 1_129del;1131_1132ins51 n/a
2 ccsbBroad304_11222 pLX_304 0% 90.9% 90.9% V5 1_129del;1131_1132ins51 n/a
3 TRCN0000470726 CTGCACAGCCGGGGGATGACAACG pLX_317 24.4% 90.9% 90.9% V5 1_129del;1131_1132ins51 n/a
Download CSV