Transcript: Human NM_001324188.2

Homo sapiens leucine rich repeat neuronal 1 (LRRN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
LRRN1 (57633)
Length:
6242
CDS:
1050..3200

Additional Resources:

NCBI RefSeq record:
NM_001324188.2
NBCI Gene record:
LRRN1 (57633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156720 GCGTCCATTGCTGTGTACTTT pLKO.1 2985 CDS 100% 5.625 7.875 N LRRN1 n/a
2 TRCN0000152768 GCTAGACTTGTTACCTTCGTT pLKO.1 3686 3UTR 100% 3.000 4.200 N LRRN1 n/a
3 TRCN0000153607 CCACAACTTTGCGTATGTGAA pLKO.1 1146 CDS 100% 4.950 3.960 N LRRN1 n/a
4 TRCN0000153688 CCACCTGAACTCCAACAAATT pLKO.1 1565 CDS 100% 13.200 9.240 N LRRN1 n/a
5 TRCN0000152022 CCACAACCAAATTAGCACTAT pLKO.1 1502 CDS 100% 4.950 3.465 N LRRN1 n/a
6 TRCN0000153132 GCTGAACAACAATGCCTTGAA pLKO.1 2078 CDS 100% 4.950 3.465 N LRRN1 n/a
7 TRCN0000156959 GCAGACAGAATCCCATTCCAT pLKO.1 2645 CDS 100% 3.000 2.100 N LRRN1 n/a
8 TRCN0000152564 GCCTTGAATGCCATTTACCAA pLKO.1 2091 CDS 100% 3.000 2.100 N LRRN1 n/a
9 TRCN0000108482 CCACTCATTAACCTCTGGGAA pLKO.1 3096 CDS 100% 2.640 1.848 N Lrrn1 n/a
10 TRCN0000158312 CCACTCATTAACCTCTGGGAA pLKO.1 3096 CDS 100% 2.640 1.848 N LRRN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08752 pDONR223 100% 99.8% 99.8% None 255A>G;791A>G;1551T>C n/a
2 ccsbBroad304_08752 pLX_304 0% 99.8% 99.8% V5 255A>G;791A>G;1551T>C n/a
3 TRCN0000491979 GCGATTTTTTGTTGCACCATTCAT pLX_317 14% 99.8% 99.8% V5 255A>G;791A>G;1551T>C n/a
Download CSV