Transcript: Human NM_001324220.2

Homo sapiens 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HMGCS1 (3157)
Length:
5370
CDS:
147..1709

Additional Resources:

NCBI RefSeq record:
NM_001324220.2
NBCI Gene record:
HMGCS1 (3157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218729 GATCTTTCACTCACCATATTG pLKO_005 929 CDS 100% 13.200 18.480 N HMGCS1 n/a
2 TRCN0000412510 GATCTTTCACTCACCATATTG pLKO_005 929 CDS 100% 13.200 18.480 N Hmgcs1 n/a
3 TRCN0000045843 CCCATCATTTGGTCAACTATA pLKO.1 1444 CDS 100% 13.200 10.560 N HMGCS1 n/a
4 TRCN0000045844 CGACAAATCAAAGTCTGTGAA pLKO.1 440 CDS 100% 4.950 3.960 N HMGCS1 n/a
5 TRCN0000230558 AGGTACTAATCTCCAATTAAA pLKO_005 2050 3UTR 100% 15.000 10.500 N HMGCS1 n/a
6 TRCN0000230556 CATCATTTGGTCAACTATATT pLKO_005 1446 CDS 100% 15.000 10.500 N HMGCS1 n/a
7 TRCN0000230557 ACATAGCAACTGAGCATATTC pLKO_005 1606 CDS 100% 13.200 9.240 N HMGCS1 n/a
8 TRCN0000418756 CAGAGACAATCATCGACAAAT pLKO_005 427 CDS 100% 13.200 9.240 N Hmgcs1 n/a
9 TRCN0000230555 TGTTGCCCTTGAGATCTATTT pLKO_005 203 CDS 100% 13.200 9.240 N HMGCS1 n/a
10 TRCN0000045846 CCACAGGAAATGCTAGACCTA pLKO.1 637 CDS 100% 2.640 1.848 N HMGCS1 n/a
11 TRCN0000045845 CCTGATATGCTATCTGAATAT pLKO.1 765 CDS 100% 13.200 7.920 N HMGCS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.