Transcript: Human NM_001324268.1

Homo sapiens transmembrane channel like 7 (TMC7), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TMC7 (79905)
Length:
4253
CDS:
1009..2154

Additional Resources:

NCBI RefSeq record:
NM_001324268.1
NBCI Gene record:
TMC7 (79905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433260 ACCTAACCCAGCCCTTAATTA pLKO_005 2304 3UTR 100% 15.000 21.000 N TMC7 n/a
2 TRCN0000433596 ATATTGTATCTACCGTCTATT pLKO_005 1198 CDS 100% 13.200 18.480 N TMC7 n/a
3 TRCN0000044427 CCCAGTCTTACTCACGAAATA pLKO.1 691 5UTR 100% 13.200 18.480 N TMC7 n/a
4 TRCN0000423564 AGCGGAGACTAAGGGACATTC pLKO_005 429 5UTR 100% 10.800 15.120 N Tmc7 n/a
5 TRCN0000044424 CCCAATGATCTTTGCCAAGAT pLKO.1 1245 CDS 100% 0.495 0.693 N TMC7 n/a
6 TRCN0000044426 GCACTGGGATTCAGTCCTATT pLKO.1 600 5UTR 100% 10.800 8.640 N TMC7 n/a
7 TRCN0000044425 GCTACCTAATCCAGAAACTAA pLKO.1 2105 CDS 100% 5.625 4.500 N TMC7 n/a
8 TRCN0000416413 GTATTTGAGCCACGAGTTTAT pLKO_005 2459 3UTR 100% 13.200 9.240 N TMC7 n/a
9 TRCN0000044423 CCTGTGAACTTCCTCCAAGAA pLKO.1 236 5UTR 100% 4.950 3.465 N TMC7 n/a
10 TRCN0000068972 GCTGATGATCTTCGACTTCAT pLKO.1 1473 CDS 100% 4.950 3.465 N Tmc7 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2840 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08983 pDONR223 100% 52.6% 52.6% None 0_1ins1026;915G>A n/a
2 ccsbBroad304_08983 pLX_304 0% 52.6% 52.6% V5 0_1ins1026;915G>A n/a
3 TRCN0000471937 ACCCCCAACCTTGAGAAGCTACAC pLX_317 17.3% 52.6% 52.6% V5 0_1ins1026;915G>A n/a
Download CSV