Transcript: Human NM_001324304.1

Homo sapiens ribophorin II (RPN2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RPN2 (6185)
Length:
2593
CDS:
312..2255

Additional Resources:

NCBI RefSeq record:
NM_001324304.1
NBCI Gene record:
RPN2 (6185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011910 CCACTGAAGTTGGCATCACAA pLKO.1 1420 CDS 100% 4.950 6.930 N Rpn2 n/a
2 TRCN0000166805 CCACTGAAGTTGGCATCACAA pLKO.1 1420 CDS 100% 4.950 6.930 N RPN2 n/a
3 TRCN0000278089 CCACTGAAGTTGGCATCACAA pLKO_005 1420 CDS 100% 4.950 6.930 N Rpn2 n/a
4 TRCN0000166435 CTACTGGACTCAGCTCAACAT pLKO.1 2087 CDS 100% 4.950 6.930 N RPN2 n/a
5 TRCN0000159361 GCCACTGTTAAACTAGAACAT pLKO.1 1218 CDS 100% 4.950 6.930 N RPN2 n/a
6 TRCN0000165507 GCTGGGACTCATGTATGTCTA pLKO.1 2069 CDS 100% 4.950 6.930 N RPN2 n/a
7 TRCN0000159835 GTCCAGATTGTAGTTATACTT pLKO.1 2370 3UTR 100% 5.625 3.938 N RPN2 n/a
8 TRCN0000159566 CAATTCACAGTATGAGAAGAA pLKO.1 2312 3UTR 100% 4.950 3.465 N RPN2 n/a
9 TRCN0000159615 GAACAATTCACAGTATGAGAA pLKO.1 2309 3UTR 100% 4.950 3.465 N RPN2 n/a
10 TRCN0000158787 GCCCTTTCACAAATTTGGAAT pLKO.1 439 CDS 100% 4.950 3.465 N RPN2 n/a
11 TRCN0000159696 GTCAAGAACAATTCACAGTAT pLKO.1 2304 3UTR 100% 4.950 3.465 N RPN2 n/a
12 TRCN0000165953 GCCAGACAACAAGAACGTGTA pLKO.1 1667 CDS 100% 4.050 2.835 N RPN2 n/a
13 TRCN0000165058 CGCGATCTTCAGCAAGAAGAA pLKO.1 1025 CDS 100% 0.495 0.347 N RPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06889 pDONR223 100% 97.4% 97.2% None 1825C>T;1883_1930del n/a
2 ccsbBroad304_06889 pLX_304 0% 97.4% 97.2% V5 1825C>T;1883_1930del n/a
3 TRCN0000468836 CCGGATGGGTGTAGACAACCATGT pLX_317 20.2% 97.4% 97.2% V5 1825C>T;1883_1930del n/a
Download CSV