Construct: ORF TRCN0000468836
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009500.1_s317c1
- Derived from:
- ccsbBroadEn_06889
- DNA Barcode:
- CCGGATGGGTGTAGACAACCATGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPN2 (6185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468836
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6185 | RPN2 | ribophorin II | NM_002951.5 | 99.9% | 100% | 1825C>T |
| 2 | human | 6185 | RPN2 | ribophorin II | NM_001324303.2 | 98.3% | 98.4% | 1825C>T;1881_1882insAGAAC;1889_1914del |
| 3 | human | 6185 | RPN2 | ribophorin II | NM_001324305.1 | 97.4% | 97.5% | 480_527del;1873C>T |
| 4 | human | 6185 | RPN2 | ribophorin II | NM_001324304.1 | 97.4% | 97.2% | 1825C>T;1883_1930del |
| 5 | human | 6185 | RPN2 | ribophorin II | NM_001324301.1 | 95.1% | 94.8% | 480_527del;1873C>T;1931_1978del |
| 6 | human | 6185 | RPN2 | ribophorin II | NM_001324302.1 | 94.8% | 94.9% | 1580_1581ins96;1729C>T |
| 7 | human | 6185 | RPN2 | ribophorin II | XM_006723852.3 | 92.5% | 92.5% | 480_527del;1628_1629ins96;1777C>T |
| 8 | human | 6185 | RPN2 | ribophorin II | NM_001135771.2 | 92.5% | 92.2% | 205_206ins96;1729C>T;1787_1834del |
| 9 | human | 6185 | RPN2 | ribophorin II | NM_001324299.1 | 92.5% | 92.2% | 1580_1581ins96;1729C>T;1787_1834del |
| 10 | human | 6185 | RPN2 | ribophorin II | XM_006723851.3 | 90.2% | 90% | (many diffs) |
| 11 | human | 6185 | RPN2 | ribophorin II | NM_001324306.1 | 73% | 72.4% | (many diffs) |
| 12 | mouse | 20014 | Rpn2 | ribophorin II | NM_019642.4 | 88.3% | 92.3% | (many diffs) |
| 13 | mouse | 20014 | Rpn2 | ribophorin II | XM_006499022.2 | 86.1% | 89.7% | (many diffs) |
| 14 | mouse | 20014 | Rpn2 | ribophorin II | XM_006499023.2 | 85.6% | 89% | (many diffs) |
| 15 | mouse | 20014 | Rpn2 | ribophorin II | XM_006499021.3 | 85% | 88.6% | (many diffs) |
| 16 | mouse | 20014 | Rpn2 | ribophorin II | XM_011239388.1 | 83.7% | 87% | (many diffs) |
| 17 | mouse | 20014 | Rpn2 | ribophorin II | XM_006499024.3 | 83% | 86.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1959
- ORF length:
- 1893
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gccgccgggt tcaagcactg tcttcctgtt ggccctgaca atcatagcca 121 gcacctgggc tctgacgccc actcactacc tcaccaagca tgacgtggag agactaaaag 181 cctcgctgga tcgccctttc acaaatttgg aatctgcctt ctactccatc gtgggactca 241 gcagccttgg tgctcaggtg ccagatgcaa agaaagcatg tacctacatc agatctaacc 301 ttgatcccag caatgtggat tccctcttct acgctgccca ggccagccag gccctctcag 361 gatgtgagat ctctatttca aatgagacca aagatctgct tctggcagct gtcagtgagg 421 actcatctgt tacccagatc taccatgcag ttgcagctct aagtggcttt ggccttccct 481 tggcatccca agaagcactc agtgccctta ctgctcgtct cagcaaggag gagactgtgc 541 tggcaacagt ccaggctctg cagacagcat cccacctgtc ccagcaggct gacctgagga 601 gcatcgtgga ggagattgag gaccttgttg ctcgcctgga tgaactcggg ggcgtgtatc 661 tccagtttga agaaggactg gaaacaacag cgttatttgt ggctgccacc tacaagctca 721 tggatcatgt ggggactgag ccatccatta aggaggatca ggtcatccag ctgatgaacg 781 cgatcttcag caagaagaac tttgagtccc tctccgaagc cttcagcgtg gcctctgcag 841 ctgctgtgct ctcgcataat cgctaccacg tgccagttgt ggttgtgcct gagggctctg 901 cttccgacac tcatgaacag gctatcttgc ggttgcaagt caccaatgtt ctgtctcagc 961 ctctgactca ggccactgtt aaactagaac atgctaaatc tgttgcttcc agagccactg 1021 tcctccagaa gacatccttc acccctgtag gggatgtttt tgaactaaat ttcatgaacg 1081 tcaaattttc cagtggttat tatgacttcc ttgtcgaagt tgaaggtgac aaccggtata 1141 ttgcaaatac cgtagagctc agagtcaaga tctccactga agttggcatc acaaatgttg 1201 atctttccac cgtggataag gatcagagca ttgcacccaa aactacccgg gtgacatacc 1261 cagccaaagc caagggcaca ttcatcgcag acagccacca gaacttcgcc ttgttcttcc 1321 agctggtaga tgtgaacact ggtgctgaac tcactcctca ccagacattt gtccgactcc 1381 ataaccagaa gactggccag gaagtggtgt ttgttgccga gccagacaac aagaacgtgt 1441 acaagtttga actggatacc tctgaaagaa agattgaatt tgactctgcc tctggcacct 1501 acactctcta cttaatcatt ggagatgcca ctttgaagaa cccaatcctc tggaatgtgg 1561 ctgatgtggt catcaagttc ccTGAGGAAG AAGCTCCCTC GACTGTCTTG TCCCAGAACC 1621 TTTTCACTCC AAAACAGGAA ATTCAGCACC TGTTCCGCGA GCCTGAGAAG AGGCCCCCCA 1681 CCGTGGTGTC CAATACATTC ACTGCCCTGA TCCTCTCGCC GTTGCTTCTG CTCTTCGCTC 1741 TGTGGATCCG GATTGGTGCC AATGTCTCCA ACTTCACTTT TGCTCCTAGC ACGATTATAT 1801 TTCACCTGGG ACATGCTGCT ATGCTGGGAC TCATGTATGT CTACTGGACT CAGCTCAACA 1861 TGTTCCAGAC CTTGAAGTAC CTGGCCATCT TGGGCAGTGT GACGTTTCTG GCTGGCAATC 1921 GGATGCTGGC CCAGCAGGCA GTCAAGAGAA CAGCACATTA CCCAACTTTC TTGTACAAAG 1981 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 2041 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 2101 ACGACCGGAT GGGTGTAGAC AACCATGTAC GCGTTAAGTC gacaatcaac ctctggatta 2161 caaaatttgt gaaagatt