Transcript: Human NM_001324389.2

Homo sapiens homeobox containing 1 (HMBOX1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HMBOX1 (79618)
Length:
3816
CDS:
342..1562

Additional Resources:

NCBI RefSeq record:
NM_001324389.2
NBCI Gene record:
HMBOX1 (79618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015012 CCTCCCTGAAAGTATATAATT pLKO.1 1306 CDS 100% 15.000 21.000 N HMBOX1 n/a
2 TRCN0000273662 CCTCCCTGAAAGTATATAATT pLKO_005 1306 CDS 100% 15.000 21.000 N HMBOX1 n/a
3 TRCN0000015011 GAGGGAGAATAATGAGCGATT pLKO.1 695 CDS 100% 4.050 5.670 N HMBOX1 n/a
4 TRCN0000285018 GAGGGAGAATAATGAGCGATT pLKO_005 695 CDS 100% 4.050 5.670 N HMBOX1 n/a
5 TRCN0000273599 GAAAGTGCTTCCAGGTATTTA pLKO_005 1989 3UTR 100% 15.000 12.000 N HMBOX1 n/a
6 TRCN0000273600 TGCGACGAGGGAGTCGATTTA pLKO_005 1138 CDS 100% 13.200 10.560 N HMBOX1 n/a
7 TRCN0000335882 GACTGATCAGGGAGGTTAAAC pLKO_005 1704 3UTR 100% 13.200 9.240 N HMBOX1 n/a
8 TRCN0000015010 GCCTGGCTGTTATGGAAAGTT pLKO.1 1174 CDS 100% 5.625 3.938 N HMBOX1 n/a
9 TRCN0000015009 CCGATGGTATCAACTTGAGAA pLKO.1 1007 CDS 100% 4.950 3.465 N HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12575 pDONR223 100% 76% 76.1% None 1_288del;1030_1032delGAA;1210A>C n/a
2 ccsbBroad304_12575 pLX_304 0% 76% 76.1% V5 1_288del;1030_1032delGAA;1210A>C n/a
3 TRCN0000472482 AATTTAAAATGATCCCAGGCATCA pLX_317 44.4% 76% 76.1% V5 1_288del;1030_1032delGAA;1210A>C n/a
Download CSV