Transcript: Human NM_001324504.2

Homo sapiens lysine methyltransferase 5A (KMT5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KMT5A (387893)
Length:
2686
CDS:
68..1036

Additional Resources:

NCBI RefSeq record:
NM_001324504.2
NBCI Gene record:
KMT5A (387893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359372 TTGAACAGATGGCCTTATATT pLKO_005 1224 3UTR 100% 15.000 21.000 N KMT5A n/a
2 TRCN0000359303 CACCCGTGGCTGAAGCATTAA pLKO_005 1016 CDS 100% 13.200 18.480 N KMT5A n/a
3 TRCN0000148268 GTTTCCTGAAACTGGGTTAAT pLKO.1 1748 3UTR 100% 13.200 18.480 N KMT5A n/a
4 TRCN0000130036 GAATCGCAAACTTACGGATTT pLKO.1 508 CDS 100% 10.800 15.120 N KMT5A n/a
5 TRCN0000359304 CCGAGGAACAGAAGATCAAAG pLKO_005 309 CDS 100% 10.800 8.640 N KMT5A n/a
6 TRCN0000130139 CGCAACAGAATCGCAAACTTA pLKO.1 501 CDS 100% 5.625 4.500 N KMT5A n/a
7 TRCN0000359373 GCCTAGGAAGACTGATCAATC pLKO_005 852 CDS 100% 10.800 7.560 N KMT5A n/a
8 TRCN0000149455 GAAACCATTAGCCGGAATCTA pLKO.1 232 CDS 100% 5.625 3.938 N KMT5A n/a
9 TRCN0000128082 CAAAGGACAAAGTGCCCTCAA pLKO.1 1078 3UTR 100% 4.050 2.835 N KMT5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10090 pDONR223 99.7% 91.3% 91.1% None 26_27ins90;857C>G n/a
2 TRCN0000469703 CTAATGACGTGGACCACCAACCCG pLX_317 46.1% 91.3% 91.1% V5 26_27ins90;857C>G n/a
3 ccsbBroad304_10090 pLX_304 62.4% 91.2% 32.9% V5 (not translated due to prior stop codon) 26_27ins90;342delT;857C>G n/a
Download CSV