Transcript: Human NM_001326579.1

Homo sapiens syntaxin 7 (STX7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
STX7 (8417)
Length:
4134
CDS:
115..900

Additional Resources:

NCBI RefSeq record:
NM_001326579.1
NBCI Gene record:
STX7 (8417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065053 CCAGAGGATCTCTTCTAACAT pLKO.1 159 CDS 100% 5.625 7.875 N STX7 n/a
2 TRCN0000299051 CCAGAGGATCTCTTCTAACAT pLKO_005 159 CDS 100% 5.625 7.875 N STX7 n/a
3 TRCN0000065054 GCGATTATCAGTCTCATCATA pLKO.1 862 CDS 100% 5.625 7.875 N STX7 n/a
4 TRCN0000298983 GCGATTATCAGTCTCATCATA pLKO_005 862 CDS 100% 5.625 7.875 N STX7 n/a
5 TRCN0000065055 CGTCTTATTCATGAGAGAGAA pLKO.1 610 CDS 100% 4.950 6.930 N STX7 n/a
6 TRCN0000298981 CGTCTTATTCATGAGAGAGAA pLKO_005 610 CDS 100% 4.950 6.930 N STX7 n/a
7 TRCN0000065056 CAGCAGATTATCAGCGCAAAT pLKO.1 794 CDS 100% 10.800 7.560 N STX7 n/a
8 TRCN0000299054 CAGCAGATTATCAGCGCAAAT pLKO_005 794 CDS 100% 10.800 7.560 N STX7 n/a
9 TRCN0000065057 GTTCACAACATCACTGACAAA pLKO.1 402 CDS 100% 4.950 3.465 N STX7 n/a
10 TRCN0000298982 GTTCACAACATCACTGACAAA pLKO_005 402 CDS 100% 4.950 3.465 N STX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01925 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01925 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474079 CACCGTCAAGCTCCTCGGATAATC pLX_317 71.3% 100% 100% V5 n/a
Download CSV