Transcript: Mouse NM_001327939.1

Mus musculus ankyrin 2, brain (Ank2), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ank2 (109676)
Length:
14327
CDS:
255..11957

Additional Resources:

NCBI RefSeq record:
NM_001327939.1
NBCI Gene record:
Ank2 (109676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001327939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423710 AGACATATCTGTCGGTTATTC pLKO_005 11075 CDS 100% 13.200 18.480 N Ank2 n/a
2 TRCN0000090849 GCCTGGTCATTGTTGAGTCAA pLKO.1 11434 CDS 100% 4.950 6.930 N Ank2 n/a
3 TRCN0000090852 GCATAGTGAATTGGTAAAGAA pLKO.1 3596 CDS 100% 5.625 4.500 N Ank2 n/a
4 TRCN0000421419 ACTGGTGCATCAAGCTATTTG pLKO_005 4310 CDS 100% 13.200 9.240 N Ank2 n/a
5 TRCN0000412520 ATTATCTGTGTGCCATATATG pLKO_005 3954 CDS 100% 13.200 9.240 N Ank2 n/a
6 TRCN0000437157 CATTATCCCACCTCGGAAATG pLKO_005 3065 CDS 100% 10.800 7.560 N Ank2 n/a
7 TRCN0000090848 CCGGTGTTCATTGCTGCTTTA pLKO.1 12961 3UTR 100% 10.800 7.560 N Ank2 n/a
8 TRCN0000090851 CGTTCCTGACTCTCTCTGTAA pLKO.1 11270 CDS 100% 4.950 3.465 N Ank2 n/a
9 TRCN0000090850 CGACAGATTCAGGAGTCTGTT pLKO.1 3906 CDS 100% 0.495 0.347 N Ank2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 13195 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001327939.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.