Transcript: Human NM_001328422.2

Homo sapiens RPGRIP1 like (RPGRIP1L), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RPGRIP1L (23322)
Length:
2441
CDS:
65..442

Additional Resources:

NCBI RefSeq record:
NM_001328422.2
NBCI Gene record:
RPGRIP1L (23322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001328422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062005 CCTGTGAAAGATACAGGTCTA pLKO.1 101 CDS 100% 0.405 0.324 N RPGRIP1L n/a
2 TRCN0000256934 ACTTCAACAACACGGACAATG pLKO_005 152 CDS 100% 10.800 7.560 N RPGRIP1L n/a
3 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 961 3UTR 100% 4.950 2.475 Y ERAP2 n/a
4 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1000 3UTR 100% 4.050 2.025 Y P3H4 n/a
5 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1000 3UTR 100% 4.050 2.025 Y ORAI2 n/a
6 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1000 3UTR 100% 4.050 2.025 Y P3H4 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1556 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1556 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 962 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001328422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.