Transcript: Human NM_001328619.2

Homo sapiens solute carrier family 2 member 5 (SLC2A5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC2A5 (6518)
Length:
4255
CDS:
270..1775

Additional Resources:

NCBI RefSeq record:
NM_001328619.2
NBCI Gene record:
SLC2A5 (6518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001328619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043003 GCACTGCTCATGCAACAATTT pLKO.1 396 CDS 100% 13.200 18.480 N SLC2A5 n/a
2 TRCN0000043004 CGCCACATCATTTGAGCTTAT pLKO.1 632 CDS 100% 10.800 15.120 N SLC2A5 n/a
3 TRCN0000043007 CAAGACGTTCATAGAGATCAA pLKO.1 1664 CDS 100% 4.950 6.930 N SLC2A5 n/a
4 TRCN0000043005 CCCGTACAGCTTCATTGTCTT pLKO.1 1583 CDS 100% 4.950 6.930 N SLC2A5 n/a
5 TRCN0000043006 CCTTGCTGTTCAACAACATAT pLKO.1 571 CDS 100% 13.200 9.240 N SLC2A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001328619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01543 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01543 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473805 ACCCCTTGAGGAGTACAGCTTATG pLX_317 22.9% 100% 100% V5 n/a
4 ccsbBroadEn_01544 pDONR223 100% 45.4% 38% None (many diffs) n/a
5 ccsbBroad304_01544 pLX_304 0% 45.4% 38% V5 (many diffs) n/a
6 TRCN0000469408 GTATGTTGGACATGTTCAGGTGTT pLX_317 48.9% 45.4% 38% V5 (many diffs) n/a
Download CSV