Transcript: Mouse NM_001329047.1

Mus musculus melanoma inhibitory activity 2 (Mia2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Mia2 (338320)
Length:
4571
CDS:
1..4194

Additional Resources:

NCBI RefSeq record:
NM_001329047.1
NBCI Gene record:
Mia2 (338320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001329047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175257 CAAGTGAATGATCTCGATAAA pLKO.1 2497 CDS 100% 13.200 18.480 N n/a
2 TRCN0000292690 CAAGTGAATGATCTCGATAAA pLKO_005 2497 CDS 100% 13.200 18.480 N n/a
3 TRCN0000416353 CAATCCACCATTACAAGATAT pLKO_005 999 CDS 100% 13.200 18.480 N Mia2 n/a
4 TRCN0000424558 GATTTGGTATGCTAGGCTTTA pLKO_005 1139 CDS 100% 10.800 15.120 N Mia2 n/a
5 TRCN0000173797 CCGATCAATTCGAAGCCGATT pLKO.1 1962 CDS 100% 4.050 5.670 N n/a
6 TRCN0000292688 CCGATCAATTCGAAGCCGATT pLKO_005 1962 CDS 100% 4.050 5.670 N n/a
7 TRCN0000191529 GAAGAACATATGTACCCATAT pLKO.1 415 CDS 100% 0.000 0.000 N Mia2 n/a
8 TRCN0000416455 AGTGAACAGAGTGAATTAAAC pLKO_005 382 CDS 100% 13.200 9.240 N Mia2 n/a
9 TRCN0000191687 GAAGTCGAAATGCCAACTAAA pLKO.1 316 CDS 100% 13.200 9.240 N Mia2 n/a
10 TRCN0000194525 GCAGTCATTTCCGTCTCATTT pLKO.1 4213 3UTR 100% 13.200 9.240 N n/a
11 TRCN0000431706 GTGAGGGCCTTACAAGTTATT pLKO_005 929 CDS 100% 13.200 9.240 N Mia2 n/a
12 TRCN0000437585 GAATCTGAGACGGAGAGTATC pLKO_005 880 CDS 100% 10.800 7.560 N Mia2 n/a
13 TRCN0000200887 GAGGACACAGAATTACCATTT pLKO.1 1405 CDS 100% 10.800 7.560 N Mia2 n/a
14 TRCN0000412507 GATAACCTCAAACATCCTATA pLKO_005 1219 CDS 100% 10.800 7.560 N Mia2 n/a
15 TRCN0000175023 GCTGATTTATGCAGCTAAGTT pLKO.1 2733 CDS 100% 5.625 3.938 N n/a
16 TRCN0000292687 GCTGATTTATGCAGCTAAGTT pLKO_005 2733 CDS 100% 5.625 3.938 N n/a
17 TRCN0000192180 CGGGAGAAGAGATATCTGTTT pLKO.1 185 CDS 100% 4.950 3.465 N Mia2 n/a
18 TRCN0000173423 GCCTGCTAAAGATGAAGGATT pLKO.1 2603 CDS 100% 4.950 3.465 N n/a
19 TRCN0000292689 GCCTGCTAAAGATGAAGGATT pLKO_005 2603 CDS 100% 4.950 3.465 N n/a
20 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 4235 3UTR 100% 0.495 0.347 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10968 pDONR223 100% 43.6% 40.6% None (many diffs) n/a
2 ccsbBroad304_10968 pLX_304 0% 43.6% 40.6% V5 (many diffs) n/a
3 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 43.6% 40.6% V5 (many diffs) n/a
Download CSV