Transcript: Human NM_001329096.2

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GALNT14 (79623)
Length:
2632
CDS:
600..2198

Additional Resources:

NCBI RefSeq record:
NM_001329096.2
NBCI Gene record:
GALNT14 (79623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421183 CATGTTCTCAAGGCCGTTAAG pLKO_005 2403 3UTR 100% 10.800 15.120 N GALNT14 n/a
2 TRCN0000035214 CCCTAAGGTTTGGTCCTTGTT pLKO.1 477 5UTR 100% 4.950 6.930 N GALNT14 n/a
3 TRCN0000035218 CGGGAAATCATATTAGTGGAT pLKO.1 969 CDS 100% 2.640 3.696 N GALNT14 n/a
4 TRCN0000423406 GGTGAAATGCTTGCGCAATAA pLKO_005 1040 CDS 100% 13.200 9.240 N GALNT14 n/a
5 TRCN0000420845 GTGTGCCCTGTGATCGATATC pLKO_005 1209 CDS 100% 10.800 7.560 N GALNT14 n/a
6 TRCN0000427872 AGTCATTCCCTGATTGGTATC pLKO_005 2438 3UTR 100% 6.000 4.200 N GALNT14 n/a
7 TRCN0000035215 CCTGTCAGTCATCACCTTGTT pLKO.1 1967 CDS 100% 4.950 3.465 N GALNT14 n/a
8 TRCN0000093696 CGGCGGTATCTGAATGCCAAA pLKO.1 714 CDS 100% 4.050 2.835 N Galnt14 n/a
9 TRCN0000035217 CTGGAGAATATCTACCCTGAA pLKO.1 1749 CDS 100% 4.050 2.835 N GALNT14 n/a
10 TRCN0000035216 GCTGTTCTTCTGGGTAACCAA pLKO.1 417 5UTR 100% 3.000 2.100 N GALNT14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08938 pDONR223 100% 94.7% 92.5% None (many diffs) n/a
2 ccsbBroad304_08938 pLX_304 0% 94.7% 92.5% V5 (many diffs) n/a
3 TRCN0000477968 TTGTCACCTATGATACTTTATTAA pLX_317 11.3% 94.7% 92.5% V5 (many diffs) n/a
Download CSV