Transcript: Mouse NM_001329107.1

Mus musculus transforming growth factor, beta 2 (Tgfb2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Tgfb2 (21808)
Length:
5200
CDS:
1216..2544

Additional Resources:

NCBI RefSeq record:
NM_001329107.1
NBCI Gene record:
Tgfb2 (21808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001329107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066096 CCCTCGACATGGATCAGTTTA pLKO.1 1292 CDS 100% 13.200 18.480 N Tgfb2 n/a
2 TRCN0000313040 TACTACGCCAAGGAGGTTTAT pLKO_005 1507 CDS 100% 13.200 18.480 N Tgfb2 n/a
3 TRCN0000349810 AGGCGAGATTTGCAGGTATTG pLKO_005 2039 CDS 100% 10.800 15.120 N Tgfb2 n/a
4 TRCN0000066094 GCCGTCTAATAATTACATCAT pLKO.1 1995 CDS 100% 4.950 6.930 N Tgfb2 n/a
5 TRCN0000312049 GCCGTCTAATAATTACATCAT pLKO_005 1995 CDS 100% 4.950 6.930 N Tgfb2 n/a
6 TRCN0000066097 CCGCTTTGATGTCTCAACAAT pLKO.1 1689 CDS 100% 5.625 4.500 N Tgfb2 n/a
7 TRCN0000313122 AGCCTGTACAACACCATAAAT pLKO_005 2392 CDS 100% 15.000 10.500 N Tgfb2 n/a
8 TRCN0000066093 CGGTGAAATGTTGACCTGTTT pLKO.1 3395 3UTR 100% 4.950 3.465 N Tgfb2 n/a
9 TRCN0000312105 CGGTGAAATGTTGACCTGTTT pLKO_005 3395 3UTR 100% 4.950 3.465 N Tgfb2 n/a
10 TRCN0000033426 GCTTTAGAAATGTGCAGGATA pLKO.1 2225 CDS 100% 4.950 3.465 N TGFB2 n/a
11 TRCN0000066095 GCTTTCCAATATGATTGTCAA pLKO.1 2505 CDS 100% 4.950 3.465 N Tgfb2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4395 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07057 pDONR223 100% 83.5% 89.3% None (many diffs) n/a
2 ccsbBroad304_07057 pLX_304 0% 83.5% 89.3% V5 (many diffs) n/a
3 TRCN0000476634 CGTCATACCTCACTCTAATCTTTC pLX_317 30.9% 83.5% 89.3% V5 (many diffs) n/a
Download CSV