Transcript: Human NM_001329239.2

Homo sapiens tissue factor pathway inhibitor (TFPI), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TFPI (7035)
Length:
4012
CDS:
392..1306

Additional Resources:

NCBI RefSeq record:
NM_001329239.2
NBCI Gene record:
TFPI (7035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073584 CGAGGTTATATTACCAGGTAT pLKO.1 794 CDS 100% 4.950 6.930 N TFPI n/a
2 TRCN0000291639 CGAGGTTATATTACCAGGTAT pLKO_005 794 CDS 100% 4.950 6.930 N TFPI n/a
3 TRCN0000073587 GCCCATTTAAGTACAGTGGAT pLKO.1 1119 CDS 100% 2.640 3.696 N TFPI n/a
4 TRCN0000073585 CCTGGGCAATATGAACAATTT pLKO.1 865 CDS 100% 13.200 9.240 N TFPI n/a
5 TRCN0000333214 CCTGGGCAATATGAACAATTT pLKO_005 865 CDS 100% 13.200 9.240 N TFPI n/a
6 TRCN0000073583 CGTTTGTATCAGAGTTGCTTT pLKO.1 1447 3UTR 100% 4.950 3.465 N TFPI n/a
7 TRCN0000291704 CGTTTGTATCAGAGTTGCTTT pLKO_005 1447 3UTR 100% 4.950 3.465 N TFPI n/a
8 TRCN0000073586 TCCTGGAATATGTCGAGGTTA pLKO.1 781 CDS 100% 4.950 3.465 N TFPI n/a
9 TRCN0000291638 TCCTGGAATATGTCGAGGTTA pLKO_005 781 CDS 100% 4.950 3.465 N TFPI n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2977 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2977 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07053 pDONR223 100% 76.5% 63.3% None (many diffs) n/a
2 ccsbBroad304_07053 pLX_304 0% 76.5% 63.3% V5 (many diffs) n/a
3 TRCN0000471352 GCCTAATAACGGGATTTTCCATGG pLX_317 66.1% 76.5% 63.3% V5 (many diffs) n/a
Download CSV