Transcript: Mouse NM_001329420.1

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 (Adamts15), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Adamts15 (235130)
Length:
4924
CDS:
187..2046

Additional Resources:

NCBI RefSeq record:
NM_001329420.1
NBCI Gene record:
Adamts15 (235130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001329420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031579 CGAGGGAGTAAGAGTGAAATA pLKO.1 858 CDS 100% 13.200 9.240 N Adamts15 n/a
2 TRCN0000031580 CGCTGCCATTATTACTGACTT pLKO.1 414 CDS 100% 4.950 3.465 N Adamts15 n/a
3 TRCN0000031582 CCAAGGCAAATACCTGCTCAA pLKO.1 1386 CDS 100% 4.050 2.835 N Adamts15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05159 pDONR223 100% 57.1% 61.2% None (many diffs) n/a
2 ccsbBroad304_05159 pLX_304 0% 57.1% 61.2% V5 (many diffs) n/a
3 TRCN0000467885 CTCGTCCTAAACGAACAAAACCCT pLX_317 14.1% 57.1% 61.2% V5 (many diffs) n/a
Download CSV