Transcript: Human NM_001329502.2

Homo sapiens glutathione peroxidase 1 (GPX1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GPX1 (2876)
Length:
1040
CDS:
76..390

Additional Resources:

NCBI RefSeq record:
NM_001329502.2
NBCI Gene record:
GPX1 (2876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046228 GCAAGGTACTACTTATCGAGA pLKO.1 185 CDS 100% 2.640 3.696 N GPX1 n/a
2 TRCN0000333348 GCAAGGTACTACTTATCGAGA pLKO_005 185 CDS 100% 2.640 3.696 N GPX1 n/a
3 TRCN0000418594 CAAGAACGAAGAGATTCTGAA pLKO_005 477 3UTR 100% 4.950 3.465 N GPX1 n/a
4 TRCN0000369916 CCGCTTCCAGACCATTGACAT pLKO_005 759 3UTR 100% 4.950 3.465 N GPX1 n/a
5 TRCN0000438265 ACATCGAGCCTGACATCGAAG pLKO_005 776 3UTR 100% 4.050 2.835 N GPX1 n/a
6 TRCN0000414244 CAACTTCATGCTCTTCGAGAA pLKO_005 537 3UTR 100% 4.050 2.835 N GPX1 n/a
7 TRCN0000046230 CTTCGAGAAGTGCGAGGTGAA pLKO.1 549 3UTR 100% 4.050 2.835 N GPX1 n/a
8 TRCN0000377344 CTACACCCAGATGAACGAGCT pLKO_005 240 CDS 100% 2.160 1.512 N GPX1 n/a
9 TRCN0000046229 CCGTGCAACCAGTTTGGGCAT pLKO.1 304 CDS 100% 0.720 0.504 N GPX1 n/a
10 TRCN0000046232 CCTGGAACTTTGAGAAGTTCC pLKO.1 698 3UTR 100% 0.405 0.203 Y GPX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00685 pDONR223 100% 48% 100% None (many diffs) n/a
2 ccsbBroad304_00685 pLX_304 0% 48% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470514 CTACAGGTGGGGCTCTCTCCAGTT pLX_317 75.6% 48% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV