Transcript: Human NM_001329587.2

Homo sapiens INTS3 and NABP interacting protein (INIP), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
INIP (58493)
Length:
4011
CDS:
188..433

Additional Resources:

NCBI RefSeq record:
NM_001329587.2
NBCI Gene record:
INIP (58493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138898 GCATATTGCAGCCCAACAGAA pLKO.1 270 CDS 100% 4.950 3.465 N INIP n/a
2 TRCN0000136156 GCTGTTTAACTCTCAATCAGA pLKO.1 638 3UTR 100% 3.000 2.100 N INIP n/a
3 TRCN0000343708 GCTGTTTAACTCTCAATCAGA pLKO_005 638 3UTR 100% 3.000 2.100 N INIP n/a
4 TRCN0000136309 GCTACATGAACTGTGACTTTA pLKO.1 464 3UTR 100% 13.200 7.920 N INIP n/a
5 TRCN0000343707 GCTACATGAACTGTGACTTTA pLKO_005 464 3UTR 100% 13.200 7.920 N INIP n/a
6 TRCN0000136778 CTCTGCATTTGGGAACCTTAT pLKO.1 345 CDS 100% 10.800 6.480 N INIP n/a
7 TRCN0000343706 CTCTGCATTTGGGAACCTTAT pLKO_005 345 CDS 100% 10.800 6.480 N INIP n/a
8 TRCN0000137109 CTTAATAAGGACTTCCGGGAT pLKO.1 235 CDS 100% 2.160 1.296 N INIP n/a
9 TRCN0000135425 GTATCGTCCAAGGAATTGATT pLKO.1 588 3UTR 100% 5.625 2.813 Y INIP n/a
10 TRCN0000343778 GTATCGTCCAAGGAATTGATT pLKO_005 588 3UTR 100% 5.625 2.813 Y INIP n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1237 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000136488 CTAACCAGTCTTAACCATCTT pLKO.1 957 3UTR 100% 4.950 2.475 Y INIP n/a
13 TRCN0000138611 CTCAAGACTCTGCATTTGGGA pLKO.1 338 CDS 100% 0.750 0.375 Y INIP n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1160 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1234 3UTR 100% 4.950 2.475 Y LOC339059 n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1327 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03862 pDONR223 100% 60.4% 19.8% None 23_24ins103;210_243del n/a
2 ccsbBroad304_03862 pLX_304 0% 60.4% 19.8% V5 23_24ins103;210_243del n/a
3 TRCN0000465608 CTACAAAATTAGTCGAGAGTACAG pLX_317 100% 60.4% 19.8% V5 23_24ins103;210_243del n/a
Download CSV