Transcript: Human NM_001329788.1

Homo sapiens zona pellucida like domain containing 1 (ZPLD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ZPLD1 (131368)
Length:
3753
CDS:
263..1510

Additional Resources:

NCBI RefSeq record:
NM_001329788.1
NBCI Gene record:
ZPLD1 (131368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129045 GCAGGCTATTACGATGAAGAT pLKO.1 400 CDS 100% 4.950 6.930 N ZPLD1 n/a
2 TRCN0000129018 GCCAATTTGGATACCTGAGAT pLKO.1 1982 3UTR 100% 4.950 6.930 N ZPLD1 n/a
3 TRCN0000129259 CCAACAATTCGCAACTTGGTT pLKO.1 1317 CDS 100% 3.000 4.200 N ZPLD1 n/a
4 TRCN0000128519 CCCACAAGTTTAGTGTTGAAT pLKO.1 1463 CDS 100% 5.625 4.500 N ZPLD1 n/a
5 TRCN0000430195 CATTGGAATACCTGGTTAATA pLKO_005 735 CDS 100% 15.000 10.500 N ZPLD1 n/a
6 TRCN0000246445 TGATATCAGGAATGGTCATTC pLKO_005 1383 CDS 100% 10.800 7.560 N Zpld1 n/a
7 TRCN0000128401 GCAGAACATTGTTGGAATCTA pLKO.1 2451 3UTR 100% 5.625 3.938 N ZPLD1 n/a
8 TRCN0000129192 CCACCAACAATCATCAGCTAT pLKO.1 677 CDS 100% 4.950 3.465 N ZPLD1 n/a
9 TRCN0000129165 GAATGGTCATTCTGGGAGTTA pLKO.1 1392 CDS 100% 4.950 3.465 N ZPLD1 n/a
10 TRCN0000129895 GCTTCTAACAATTAGAGTGCT pLKO.1 286 CDS 100% 2.640 1.848 N ZPLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13159 pDONR223 100% 99.8% 99.7% None 111A>G;725A>G n/a
2 ccsbBroad304_13159 pLX_304 0% 99.8% 99.7% V5 111A>G;725A>G n/a
3 TRCN0000478128 CGTTCGTTTGTGACATAGAGCTAG pLX_317 25.5% 99.8% 99.7% V5 111A>G;725A>G n/a
Download CSV