Transcript: Human NM_001329793.2

Homo sapiens ELMO domain containing 3 (ELMOD3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ELMOD3 (84173)
Length:
2225
CDS:
294..1439

Additional Resources:

NCBI RefSeq record:
NM_001329793.2
NBCI Gene record:
ELMOD3 (84173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135161 CGAGATGAATGGAGGCTTAAA pLKO.1 1444 3UTR 100% 13.200 9.240 N ELMOD3 n/a
2 TRCN0000417725 GCTGGATATTCTCCATCATAT pLKO_005 363 CDS 100% 13.200 9.240 N ELMOD3 n/a
3 TRCN0000138508 CCGAGATGAATGGAGGCTTAA pLKO.1 1443 3UTR 100% 10.800 7.560 N ELMOD3 n/a
4 TRCN0000138843 GCACCAGTGTCTGTGTTGTTA pLKO.1 1848 3UTR 100% 5.625 3.938 N ELMOD3 n/a
5 TRCN0000135916 GAGTTGAAGAACCATGGCATT pLKO.1 429 CDS 100% 4.050 2.835 N ELMOD3 n/a
6 TRCN0000137628 GCAGCTAATCTCCTTCAGTGA pLKO.1 590 CDS 100% 2.640 1.848 N ELMOD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16028 pDONR223 0% 99.8% 99.7% None 882C>T;974G>T n/a
2 ccsbBroad304_16028 pLX_304 0% 99.8% 99.7% V5 882C>T;974G>T n/a
3 TRCN0000481137 CACATTCAGTTCACTCCAATTATC pLX_317 42.3% 99.7% 99.7% V5 846C>A;882C>T;974G>T n/a
4 ccsbBroadEn_09155 pDONR223 100% 87.3% 81.3% None (many diffs) n/a
5 ccsbBroad304_09155 pLX_304 0% 87.3% 81.3% V5 (many diffs) n/a
6 TRCN0000472678 AACTAATTAAAACTGACCGCAATC pLX_317 25.7% 87.3% 81.3% V5 (many diffs) n/a
Download CSV