Transcript: Human NM_001330004.1

Homo sapiens dynein assembly factor with WD repeats 1 (DAW1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
DAW1 (164781)
Length:
2005
CDS:
412..1614

Additional Resources:

NCBI RefSeq record:
NM_001330004.1
NBCI Gene record:
DAW1 (164781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435074 GCGAGGAAGTTTACACCTTAA pLKO_005 992 CDS 100% 10.800 15.120 N DAW1 n/a
2 TRCN0000077981 CGACTGGAAGTATGGACACAA pLKO.1 944 CDS 100% 4.950 6.930 N DAW1 n/a
3 TRCN0000421372 AGTTATGCCACTCCAATATTA pLKO_005 1781 3UTR 100% 15.000 12.000 N DAW1 n/a
4 TRCN0000430777 TTCACAGATATGACCATTAAA pLKO_005 1752 3UTR 100% 15.000 12.000 N DAW1 n/a
5 TRCN0000077978 GCAAGTCAACTATTTCTACAA pLKO.1 1720 3UTR 100% 4.950 3.465 N DAW1 n/a
6 TRCN0000077982 GCAGCAAGGATAATACCTGTA pLKO.1 1580 CDS 100% 4.050 2.835 N DAW1 n/a
7 TRCN0000077980 GCTGCTTTGATTACACTGGAA pLKO.1 1292 CDS 100% 2.640 1.848 N DAW1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09760 pDONR223 100% 96.3% 96.1% None 0_1ins45;1191G>C n/a
2 ccsbBroad304_09760 pLX_304 0% 96.3% 96.1% V5 0_1ins45;1191G>C n/a
3 TRCN0000491751 GCACTAATGCGGACGTACTGATTC pLX_317 34.7% 96.3% 96.1% V5 0_1ins45;1191G>C n/a
Download CSV