Transcript: Human NM_001330114.2

Homo sapiens calcium voltage-gated channel auxiliary subunit beta 4 (CACNB4), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CACNB4 (785)
Length:
8214
CDS:
958..1866

Additional Resources:

NCBI RefSeq record:
NM_001330114.2
NBCI Gene record:
CACNB4 (785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262798 CTAAGAGGTCTGTCCTAAATA pLKO_005 1100 CDS 100% 15.000 21.000 N CACNB4 n/a
2 TRCN0000262796 TACGATGTTGTACCGTCAATG pLKO_005 940 5UTR 100% 10.800 15.120 N CACNB4 n/a
3 TRCN0000262799 CTTGAGTCTAGATGGATATTA pLKO_005 2030 3UTR 100% 15.000 12.000 N CACNB4 n/a
4 TRCN0000044089 GCACCAATTATTGTTCATGTA pLKO.1 1285 CDS 100% 4.950 3.960 N CACNB4 n/a
5 TRCN0000044090 GCGGAAGTACAAAGTGAAATT pLKO.1 1171 CDS 100% 13.200 9.240 N CACNB4 n/a
6 TRCN0000262797 TCAGCATAGCCGAGATCATTA pLKO_005 1737 CDS 100% 13.200 9.240 N CACNB4 n/a
7 TRCN0000282424 ACATAGGCTTTGAGTCTAATG pLKO_005 1854 CDS 100% 10.800 7.560 N CACNB4 n/a
8 TRCN0000044088 CCACTCAGATTGGAGAACATA pLKO.1 783 5UTR 100% 5.625 3.938 N CACNB4 n/a
9 TRCN0000044091 CGGAGGGAAATCAAGTGGAAA pLKO.1 839 5UTR 100% 4.950 3.465 N CACNB4 n/a
10 TRCN0000044092 GCAATTCGACAGGAGAGAGAA pLKO.1 537 5UTR 100% 4.950 3.465 N CACNB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00202 pDONR223 100% 58% 58% None 0_1ins654 n/a
2 ccsbBroad304_00202 pLX_304 0% 58% 58% V5 0_1ins654 n/a
3 TRCN0000476597 TATGCGGCAACACTGTTGCCTGAA pLX_317 24.4% 58% 58% V5 0_1ins654 n/a
Download CSV