Transcript: Human NM_001330255.1

Homo sapiens transmembrane and coiled-coil domains 5A (TMCO5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
TMCO5A (145942)
Length:
1958
CDS:
191..877

Additional Resources:

NCBI RefSeq record:
NM_001330255.1
NBCI Gene record:
TMCO5A (145942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136525 CGCAGAGAATAGATGAAGCAA pLKO.1 261 CDS 100% 3.000 2.400 N TMCO5A n/a
2 TRCN0000416847 AGATCAAGCCCTCTACATAAA pLKO_005 673 CDS 100% 13.200 9.240 N TMCO5A n/a
3 TRCN0000135249 CCAGACTTGAAAGGAAGAATA pLKO.1 447 CDS 100% 13.200 9.240 N TMCO5A n/a
4 TRCN0000431042 GATAACCAATTGTGAACAAAG pLKO_005 526 CDS 100% 10.800 7.560 N TMCO5A n/a
5 TRCN0000416811 AGTACCAGGAAACGTTGAAGA pLKO_005 696 CDS 100% 4.950 3.465 N TMCO5A n/a
6 TRCN0000136413 CTCAAGGTAATGAAGGAGTAT pLKO.1 629 CDS 100% 4.950 3.465 N TMCO5A n/a
7 TRCN0000137990 GAGGCTGGAAAGTGAGATCAT pLKO.1 328 CDS 100% 4.950 2.970 N TMCO5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04979 pDONR223 100% 78.2% 77.7% None (many diffs) n/a
2 ccsbBroad304_04979 pLX_304 0% 78.2% 77.7% V5 (many diffs) n/a
Download CSV