Transcript: Human NM_001330314.2

Homo sapiens solute carrier family 35 member F5 (SLC35F5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC35F5 (80255)
Length:
10829
CDS:
767..2320

Additional Resources:

NCBI RefSeq record:
NM_001330314.2
NBCI Gene record:
SLC35F5 (80255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043867 CTGAACTTACTTCGTATGTTT pLKO.1 1008 CDS 100% 5.625 7.875 N SLC35F5 n/a
2 TRCN0000043863 CGCATGTCATATCCTGTGAAA pLKO.1 1397 CDS 100% 4.950 6.930 N SLC35F5 n/a
3 TRCN0000043865 GCACACTTGCACTAAGCCTTA pLKO.1 2028 CDS 100% 4.050 5.670 N SLC35F5 n/a
4 TRCN0000430427 TCGTGTGAGGTTCAGTAATAT pLKO_005 1324 CDS 100% 15.000 12.000 N SLC35F5 n/a
5 TRCN0000043864 GCAGGAGCTATCCCTGTATTT pLKO.1 2114 CDS 100% 13.200 9.240 N SLC35F5 n/a
6 TRCN0000435364 CAGATGCTGAAGGTTACTTTG pLKO_005 1170 CDS 100% 10.800 7.560 N SLC35F5 n/a
7 TRCN0000422602 CCAGTATTTCTGACAGGTAAA pLKO_005 2723 3UTR 100% 10.800 7.560 N SLC35F5 n/a
8 TRCN0000043866 CCTGTGAAATTCCATGATCTT pLKO.1 1247 CDS 100% 4.950 3.465 N SLC35F5 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9697 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9697 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7048 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9695 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9695 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9695 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7048 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09022 pDONR223 100% 98.2% 97.7% None (many diffs) n/a
2 ccsbBroad304_09022 pLX_304 0% 98.2% 97.7% V5 (many diffs) n/a
3 TRCN0000470941 TAGCAGGATTGGTCCTCGGCACAA pLX_317 28.3% 98.2% 97.7% V5 (many diffs) n/a
Download CSV