Transcript: Human NM_001330358.1

Homo sapiens methylenetetrahydrofolate reductase (MTHFR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MTHFR (4524)
Length:
7207
CDS:
164..2257

Additional Resources:

NCBI RefSeq record:
NM_001330358.1
NBCI Gene record:
MTHFR (4524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235026 TTACCGTAGCCTCCGTTTATG pLKO_005 4886 3UTR 100% 13.200 18.480 N MTHFR n/a
2 TRCN0000046471 CCGAAGTGAGTTTGGTGACTA pLKO.1 832 CDS 100% 4.950 6.930 N MTHFR n/a
3 TRCN0000046469 GCTGACACATTCTTCCGCTTT pLKO.1 983 CDS 100% 4.050 5.670 N MTHFR n/a
4 TRCN0000235025 AGTACGAGCTCCGGGTTAATT pLKO_005 1878 CDS 100% 15.000 10.500 N MTHFR n/a
5 TRCN0000235024 CTTTGAAGTCTTCGTTCTTTA pLKO_005 1579 CDS 100% 13.200 9.240 N MTHFR n/a
6 TRCN0000235023 ATGCTGCCATCCGCAACTATG pLKO_005 1158 CDS 100% 10.800 7.560 N MTHFR n/a
7 TRCN0000235022 GTGAGTTTGGTGACTACTTTG pLKO_005 837 CDS 100% 10.800 7.560 N MTHFR n/a
8 TRCN0000046470 CCAAAGATAGTTCGAGATGTT pLKO.1 363 CDS 100% 4.950 3.465 N MTHFR n/a
9 TRCN0000046472 CTTGTCAATGTGAAGGGTGAA pLKO.1 1904 CDS 100% 4.050 2.835 N MTHFR n/a
10 TRCN0000046468 CCTCAGTTTCTCCATCAGCTT pLKO.1 5978 3UTR 100% 2.640 1.584 N MTHFR n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6924 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6924 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6922 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6922 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6922 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492338 GACACATACGAACAAAGCGCTTTC pLX_317 20.4% 93.8% 93.6% V5 (many diffs) n/a
2 TRCN0000489142 GTTAAGGTAGCTATGACGCGCGCT pLX_317 18.4% 93.5% 93.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV