Transcript: Human NM_001330364.2

Homo sapiens SET and MYND domain containing 1 (SMYD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SMYD1 (150572)
Length:
4346
CDS:
41..1474

Additional Resources:

NCBI RefSeq record:
NM_001330364.2
NBCI Gene record:
SMYD1 (150572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130695 CGCACATCTTCGGAGTGATTA pLKO.1 552 CDS 100% 13.200 18.480 N SMYD1 n/a
2 TRCN0000359433 TTGGCTCAATTCAAGTCTATT pLKO_005 1629 3UTR 100% 13.200 18.480 N SMYD1 n/a
3 TRCN0000129092 GAGTGATTAACTGCAACGGTT pLKO.1 564 CDS 100% 2.640 3.696 N SMYD1 n/a
4 TRCN0000127839 GATCTGCAAAGCCTATGCCAT pLKO.1 1246 CDS 100% 2.640 3.696 N SMYD1 n/a
5 TRCN0000359434 GAGCTGACTGTGTCCTATATT pLKO_005 740 CDS 100% 15.000 10.500 N SMYD1 n/a
6 TRCN0000127827 GCAGTGCAAGTTTGCCCATTA pLKO.1 238 CDS 100% 10.800 7.560 N SMYD1 n/a
7 TRCN0000128991 GAGGGTTTGTATCATGAGGTT pLKO.1 965 CDS 100% 2.640 1.848 N SMYD1 n/a
8 TRCN0000359512 GGTGAAGGAGATGATACAATT pLKO_005 904 CDS 100% 13.200 7.920 N SMYD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09671 pDONR223 100% 97.2% 97.1% None 337C>A;659_660ins39 n/a
2 ccsbBroad304_09671 pLX_304 0% 97.2% 97.1% V5 337C>A;659_660ins39 n/a
3 TRCN0000470545 AAACACCCTCAGCGACATCTTATC pLX_317 25.5% 97.2% 97.1% V5 337C>A;659_660ins39 n/a
Download CSV