Transcript: Human NM_001330458.1

Homo sapiens atlastin GTPase 2 (ATL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ATL2 (64225)
Length:
3707
CDS:
432..1670

Additional Resources:

NCBI RefSeq record:
NM_001330458.1
NBCI Gene record:
ATL2 (64225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157494 GATGAGTTCTGCCGTCGTTAT pLKO.1 1230 CDS 100% 10.800 15.120 N ATL2 n/a
2 TRCN0000152894 GACCAGCTTGAAGCTGAAATT pLKO.1 1254 CDS 100% 13.200 9.240 N ATL2 n/a
3 TRCN0000152503 GCTTCGAAATCTGGTTCCATT pLKO.1 887 CDS 100% 4.950 3.465 N ATL2 n/a
4 TRCN0000156840 GTGCCTTTGATAGCCAGTCAA pLKO.1 445 CDS 100% 4.950 3.465 N ATL2 n/a
5 TRCN0000151388 GATAGCCAGTCAACTATCAAA pLKO.1 453 CDS 100% 0.563 0.394 N ATL2 n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3352 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3352 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12463 pDONR223 100% 99.9% 100% None 453A>C n/a
2 ccsbBroad304_12463 pLX_304 0% 99.9% 100% V5 453A>C n/a
3 TRCN0000471728 TGTGATCACACCCGAAAGTGGTTC pLX_317 24.8% 99.9% 100% V5 453A>C n/a
Download CSV