Transcript: Human NM_001330556.2

Homo sapiens docking protein 4 (DOK4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DOK4 (55715)
Length:
2803
CDS:
251..1348

Additional Resources:

NCBI RefSeq record:
NM_001330556.2
NBCI Gene record:
DOK4 (55715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136175 GACAGATCGCTTCAATGTCTT pLKO.1 655 CDS 100% 4.950 6.930 N DOK4 n/a
2 TRCN0000349597 GACAGATCGCTTCAATGTCTT pLKO_005 655 CDS 100% 4.950 6.930 N DOK4 n/a
3 TRCN0000136733 GAACATCTACCTCTGGGACAT pLKO.1 736 CDS 100% 4.050 2.835 N DOK4 n/a
4 TRCN0000319105 GAACATCTACCTCTGGGACAT pLKO_005 736 CDS 100% 4.050 2.835 N DOK4 n/a
5 TRCN0000137012 CAAGGTGACTGAGATCAGCAA pLKO.1 421 CDS 100% 2.640 1.848 N DOK4 n/a
6 TRCN0000319104 CAAGGTGACTGAGATCAGCAA pLKO_005 421 CDS 100% 2.640 1.848 N DOK4 n/a
7 TRCN0000134881 CAACAGATTCATCCTGCTAAA pLKO.1 1276 CDS 100% 10.800 6.480 N DOK4 n/a
8 TRCN0000319031 CAACAGATTCATCCTGCTAAA pLKO_005 1276 CDS 100% 10.800 6.480 N DOK4 n/a
9 TRCN0000247015 ACATCTACCTCTGGGACATAC pLKO_005 738 CDS 100% 10.800 7.560 N Dok4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03637 pDONR223 100% 89.3% 89.3% None 862_978del n/a
2 ccsbBroad304_03637 pLX_304 0% 89.3% 89.3% V5 862_978del n/a
3 TRCN0000469150 CTGTCAAGGCCTGTTGGTCGCTAA pLX_317 35.9% 89.3% 89.3% V5 862_978del n/a
Download CSV