Transcript: Human NM_001330669.1

Homo sapiens seryl-tRNA synthetase 1 (SARS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SARS1 (6301)
Length:
2005
CDS:
101..1711

Additional Resources:

NCBI RefSeq record:
NM_001330669.1
NBCI Gene record:
SARS1 (6301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045584 CCCATCAGTAACGATGAGGAT pLKO.1 530 CDS 100% 2.640 3.696 N SARS1 n/a
2 TRCN0000344764 CCTTACCACATTGTGAATATT pLKO_005 1172 CDS 100% 15.000 10.500 N SARS1 n/a
3 TRCN0000344822 ATGATGAGAAGTACCTGATTG pLKO_005 888 CDS 100% 10.800 7.560 N SARS1 n/a
4 TRCN0000045587 CATCAGTTTGAGAAGATTGAA pLKO.1 1055 CDS 100% 5.625 3.938 N SARS1 n/a
5 TRCN0000333350 CATCAGTTTGAGAAGATTGAA pLKO_005 1055 CDS 100% 5.625 3.938 N SARS1 n/a
6 TRCN0000045585 GCTAACCTGAAAGTCTCACAA pLKO.1 386 CDS 100% 4.950 3.465 N SARS1 n/a
7 TRCN0000333349 GCTAACCTGAAAGTCTCACAA pLKO_005 386 CDS 100% 4.950 3.465 N SARS1 n/a
8 TRCN0000045583 CCTGTTCTAATTGCACGGATT pLKO.1 1281 CDS 100% 4.050 2.835 N SARS1 n/a
9 TRCN0000045586 GCCTGAGAAATTGAAGGAGTT pLKO.1 1522 CDS 100% 4.050 2.835 N SARS1 n/a
10 TRCN0000344765 CTATTTGCCAGGCTTTCATTT pLKO_005 1726 3UTR 100% 13.200 7.920 N SARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01481 pDONR223 100% 95.8% 95.8% None 1255_1320del n/a
2 ccsbBroad304_01481 pLX_304 0% 95.8% 95.8% V5 1255_1320del n/a
3 TRCN0000465952 ACATTAGACTGTTTTTCCGTCAAT pLX_317 15.4% 95.8% 95.8% V5 1255_1320del n/a
4 ccsbBroadEn_06912 pDONR223 100% 95.8% 95.7% None 1255_1320del;1369C>T n/a
5 ccsbBroad304_06912 pLX_304 0% 95.8% 95.7% V5 1255_1320del;1369C>T n/a
6 TRCN0000466129 GCGGCCCCGGAATTAGAATATCTA pLX_317 25% 95.8% 95.7% V5 1255_1320del;1369C>T n/a
Download CSV