Transcript: Human NM_001330997.2

Homo sapiens family with sequence similarity 135 member A (FAM135A), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
FAM135A (57579)
Length:
5653
CDS:
425..4384

Additional Resources:

NCBI RefSeq record:
NM_001330997.2
NBCI Gene record:
FAM135A (57579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435565 CTCAATTCATTACCTATAATC pLKO_005 1628 CDS 100% 13.200 18.480 N FAM135A n/a
2 TRCN0000133689 GCTGTTCTTGATTCGGAAATA pLKO.1 4316 CDS 100% 13.200 18.480 N FAM135A n/a
3 TRCN0000133767 CAGTGAAACTTTAAGCCCATA pLKO.1 4643 3UTR 100% 4.050 3.240 N FAM135A n/a
4 TRCN0000418425 GACATTCGTTGGGCAATTTAA pLKO_005 3810 CDS 100% 15.000 10.500 N FAM135A n/a
5 TRCN0000264933 TGAATGCCTTGCAACTAATAA pLKO_005 804 CDS 100% 15.000 10.500 N Fam135a n/a
6 TRCN0000413297 TGAATGCCTTGCAACTAATAA pLKO_005 804 CDS 100% 15.000 10.500 N FAM135A n/a
7 TRCN0000428662 ACTTTGAGGGTACGCAGATTT pLKO_005 1445 CDS 100% 13.200 9.240 N FAM135A n/a
8 TRCN0000138590 CCACGAGAGTCTCCTTGTAAT pLKO.1 3311 CDS 100% 13.200 9.240 N FAM135A n/a
9 TRCN0000136155 GCCCGCATTGAAATGTGTAAA pLKO.1 4133 CDS 100% 13.200 9.240 N FAM135A n/a
10 TRCN0000134584 GCCTTGATTTGGTTGGAATTT pLKO.1 5111 3UTR 100% 13.200 9.240 N FAM135A n/a
11 TRCN0000412661 TGAGAGTACAAGTGCTATAAG pLKO_005 2308 CDS 100% 13.200 9.240 N FAM135A n/a
12 TRCN0000135244 CCCAACTTTGAGTCCTTAGAA pLKO.1 1916 CDS 100% 5.625 3.938 N FAM135A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08746 pDONR223 100% 99.9% 99.9% None 3137A>G n/a
2 ccsbBroad304_08746 pLX_304 0% 99.9% 99.9% V5 3137A>G n/a
3 TRCN0000471886 TCACCTAATACCTTCTTGCACCTA pLX_317 10.3% 99.9% 99.9% V5 3137A>G n/a
Download CSV