Transcript: Human NM_001331018.1

Homo sapiens VPS26 endosomal protein sorting factor C (VPS26C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
VPS26C (10311)
Length:
3476
CDS:
816..1334

Additional Resources:

NCBI RefSeq record:
NM_001331018.1
NBCI Gene record:
VPS26C (10311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423969 GTCCCGTGGACTTCACGATTA pLKO_005 898 CDS 100% 10.800 15.120 N VPS26C n/a
2 TRCN0000065227 ACCAACTTCAAAGTGGAATTT pLKO.1 1236 CDS 100% 13.200 9.240 N VPS26C n/a
3 TRCN0000421400 CAGACCCTCAAATTAACTTTC pLKO_005 1463 3UTR 100% 10.800 7.560 N VPS26C n/a
4 TRCN0000420342 TGCTATTTGCCAAGACCATTT pLKO_005 1565 3UTR 100% 10.800 7.560 N VPS26C n/a
5 TRCN0000065224 GCCACGGAGATTCAGAACATT pLKO.1 1125 CDS 100% 5.625 3.938 N VPS26C n/a
6 TRCN0000065225 GAAACCTTACAGAACGTCAAA pLKO.1 924 CDS 100% 4.950 3.465 N VPS26C n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2132 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2132 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02395 pDONR223 100% 57.9% 57.9% None 57_58ins375 n/a
2 ccsbBroad304_02395 pLX_304 0% 57.9% 57.9% V5 57_58ins375 n/a
3 TRCN0000476766 TATGCATACGAGCTGTTCTTACCG pLX_317 40.4% 57.9% 57.9% V5 57_58ins375 n/a
Download CSV