Transcript: Human NM_001331021.1

Homo sapiens VPS26 endosomal protein sorting factor C (VPS26C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
VPS26C (10311)
Length:
3707
CDS:
816..1565

Additional Resources:

NCBI RefSeq record:
NM_001331021.1
NBCI Gene record:
VPS26C (10311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423969 GTCCCGTGGACTTCACGATTA pLKO_005 1129 CDS 100% 10.800 15.120 N VPS26C n/a
2 TRCN0000065226 GAGACGTATCATGGCGTGTTT pLKO.1 990 CDS 100% 4.950 6.930 N VPS26C n/a
3 TRCN0000065227 ACCAACTTCAAAGTGGAATTT pLKO.1 1467 CDS 100% 13.200 9.240 N VPS26C n/a
4 TRCN0000421400 CAGACCCTCAAATTAACTTTC pLKO_005 1694 3UTR 100% 10.800 7.560 N VPS26C n/a
5 TRCN0000420342 TGCTATTTGCCAAGACCATTT pLKO_005 1796 3UTR 100% 10.800 7.560 N VPS26C n/a
6 TRCN0000418366 TTGGCCAAGGACTTGACAAAG pLKO_005 1056 CDS 100% 10.800 7.560 N VPS26C n/a
7 TRCN0000065224 GCCACGGAGATTCAGAACATT pLKO.1 1356 CDS 100% 5.625 3.938 N VPS26C n/a
8 TRCN0000065225 GAAACCTTACAGAACGTCAAA pLKO.1 1155 CDS 100% 4.950 3.465 N VPS26C n/a
9 TRCN0000097836 CCAGATTATCAACAGCACCAT pLKO.1 878 CDS 100% 2.640 1.848 N Dscr3 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2363 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2363 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02395 pDONR223 100% 83.8% 83.8% None 56_57ins144 n/a
2 ccsbBroad304_02395 pLX_304 0% 83.8% 83.8% V5 56_57ins144 n/a
3 TRCN0000476766 TATGCATACGAGCTGTTCTTACCG pLX_317 40.4% 83.8% 83.8% V5 56_57ins144 n/a
Download CSV