Transcript: Human NM_001331037.1

Homo sapiens GC-rich promoter binding protein 1 (GPBP1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GPBP1 (65056)
Length:
4698
CDS:
1290..2771

Additional Resources:

NCBI RefSeq record:
NM_001331037.1
NBCI Gene record:
GPBP1 (65056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422193 CATTTGGCGTTGGCAACTTTA pLKO_005 2077 CDS 100% 13.200 18.480 N GPBP1 n/a
2 TRCN0000143318 GCATGGACAGAGAATCGTTAT pLKO.1 1389 CDS 100% 10.800 15.120 N GPBP1 n/a
3 TRCN0000429124 TCTGCTATTGGGCGTCCTAAT pLKO_005 1452 CDS 100% 10.800 15.120 N GPBP1 n/a
4 TRCN0000141596 CGACGACACAACTCTTCAGAT pLKO.1 1422 CDS 100% 4.950 6.930 N GPBP1 n/a
5 TRCN0000144886 GAGTATGAGAGAGAACCAAAT pLKO.1 1716 CDS 100% 10.800 8.640 N GPBP1 n/a
6 TRCN0000143940 CCAAGAACTTTAGTCCATCTA pLKO.1 2116 CDS 100% 4.950 3.960 N GPBP1 n/a
7 TRCN0000141468 CGTCTAACCAAACTGACACGA pLKO.1 2205 CDS 100% 2.640 2.112 N GPBP1 n/a
8 TRCN0000421630 GAGAAGGATGACGACTCATTT pLKO_005 2316 CDS 100% 13.200 9.240 N GPBP1 n/a
9 TRCN0000433606 GAATATCCTCCGAATCCTAAA pLKO_005 1827 CDS 100% 10.800 7.560 N GPBP1 n/a
10 TRCN0000433107 TCATCAACAAAGTCGTCATTG pLKO_005 1341 CDS 100% 10.800 7.560 N GPBP1 n/a
11 TRCN0000142810 CAGAGACAAGTAGCAGTGATA pLKO.1 2728 CDS 100% 4.950 3.465 N GPBP1 n/a
12 TRCN0000071135 CCAAGTTATTAGTGAACAGTT pLKO.1 2594 CDS 100% 4.950 3.465 N Gpbp1 n/a
13 TRCN0000142484 GACAATGAAACCGGGAGGAAA pLKO.1 1638 CDS 100% 4.950 3.465 N GPBP1 n/a
14 TRCN0000071134 GCTGGTCATTAAGAAAGGTAA pLKO.1 1865 CDS 100% 4.950 3.465 N Gpbp1 n/a
15 TRCN0000303110 GCTGGTCATTAAGAAAGGTAA pLKO_005 1865 CDS 100% 4.950 3.465 N Gpbp1 n/a
16 TRCN0000143439 GATACATCAGATGACGACGAT pLKO.1 2745 CDS 100% 2.640 1.848 N GPBP1 n/a
17 TRCN0000143319 GAGGCAGAACACAGATTGTTA pLKO.1 2496 CDS 100% 5.625 3.375 N GPBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08887 pDONR223 100% 95.8% 95.9% None 174G>A;478_537del n/a
2 TRCN0000468929 GAGTAGAACAATCACTCTTTTACA pLX_317 32.3% 95.8% 95.9% V5 174G>A;478_537del n/a
3 ccsbBroadEn_12509 pDONR223 100% 36.7% 36.7% None 1_936del n/a
4 ccsbBroad304_12509 pLX_304 0% 36.7% 36.7% V5 1_936del n/a
5 TRCN0000479069 TTATCAGGCATCTTTTTACTTATT pLX_317 57.9% 36.7% 36.7% V5 1_936del n/a
Download CSV