Transcript: Human NM_001331092.1

Homo sapiens family with sequence similarity 122B (FAM122B), transcript variant 10, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
FAM122B (159090)
Length:
2598
CDS:
151..879

Additional Resources:

NCBI RefSeq record:
NM_001331092.1
NBCI Gene record:
FAM122B (159090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129012 GCATCCGATGTGTCCTTTATT pLKO.1 1736 3UTR 100% 15.000 21.000 N FAM122B n/a
2 TRCN0000420270 TGACAAGCCGGAGAAATTATA pLKO_005 498 CDS 100% 15.000 21.000 N FAM122B n/a
3 TRCN0000130108 CACTTAGAACTCGGAGGAATA pLKO.1 278 CDS 100% 10.800 15.120 N FAM122B n/a
4 TRCN0000129792 CGGAGGAATAGTACAACAATT pLKO.1 289 CDS 100% 13.200 9.240 N FAM122B n/a
5 TRCN0000428785 AGAGTCCAGTCAAGTGCATTA pLKO_005 659 CDS 100% 10.800 7.560 N FAM122B n/a
6 TRCN0000427416 AGGCACTACCAATATGTTATC pLKO_005 753 CDS 100% 10.800 7.560 N FAM122B n/a
7 TRCN0000128707 CCAAGGCACTACCAATATGTT pLKO.1 750 CDS 100% 5.625 3.938 N FAM122B n/a
8 TRCN0000129537 CCAGTGTTCTTGGTCCTCTTA pLKO.1 683 CDS 100% 4.950 3.465 N FAM122B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05100 pDONR223 100% 80.7% 71.5% None (many diffs) n/a
2 ccsbBroad304_05100 pLX_304 0% 80.7% 71.5% V5 (many diffs) n/a
3 TRCN0000480791 ACCAACCCCTCGTCAGTCAGCATA pLX_317 49.9% 80.7% 71.5% V5 (many diffs) n/a
Download CSV