Transcript: Human NM_001345981.2

Homo sapiens kelch like family member 26 (KLHL26), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KLHL26 (55295)
Length:
3231
CDS:
28..1962

Additional Resources:

NCBI RefSeq record:
NM_001345981.2
NBCI Gene record:
KLHL26 (55295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153714 CTCGATGTTGTGCTGACTATT pLKO.1 214 CDS 100% 13.200 18.480 N KLHL26 n/a
2 TRCN0000156605 GAACCCAAAGTCGGTGGTATA pLKO.1 2363 3UTR 100% 10.800 15.120 N KLHL26 n/a
3 TRCN0000156582 GCATCGTACAGGTGTACAACA pLKO.1 1841 CDS 100% 4.950 6.930 N KLHL26 n/a
4 TRCN0000151511 CGATGTTGTGCTGACTATTAA pLKO.1 216 CDS 100% 15.000 12.000 N KLHL26 n/a
5 TRCN0000154283 GCTGTCTCATAGATGGGATTT pLKO.1 3035 3UTR 100% 10.800 8.640 N KLHL26 n/a
6 TRCN0000158229 CCTCGATGTTGTGCTGACTAT pLKO.1 213 CDS 100% 4.950 3.465 N KLHL26 n/a
7 TRCN0000154235 CGCTAACTTCAGAATCCCATA pLKO.1 2779 3UTR 100% 4.050 2.835 N KLHL26 n/a
8 TRCN0000157771 CAACTCCTAGAAACGCTCCTT pLKO.1 2636 3UTR 100% 2.640 1.848 N KLHL26 n/a
9 TRCN0000152848 GCTCATCAACATTGAACCCAA pLKO.1 2350 3UTR 100% 2.640 1.848 N KLHL26 n/a
10 TRCN0000152745 GACTATTAACAGAGAGGCCTT pLKO.1 228 CDS 100% 2.160 1.512 N KLHL26 n/a
11 TRCN0000157258 GCTGGAGAGGAAGATCTACAT pLKO.1 1782 CDS 100% 4.950 2.970 N KLHL26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08507 pDONR223 100% 95.3% 95.3% None 261_347del;993C>T;1711G>A n/a
2 ccsbBroad304_08507 pLX_304 0% 95.3% 95.3% V5 261_347del;993C>T;1711G>A n/a
3 TRCN0000480730 ATTATGAGCCTCCATTGTAAGTTC pLX_317 24.3% 95.3% 95.3% V5 261_347del;993C>T;1711G>A n/a
Download CSV