Transcript: Mouse NM_001346087.1

Mus musculus myelin-associated glycoprotein (Mag), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Mag (17136)
Length:
2537
CDS:
245..1993

Additional Resources:

NCBI RefSeq record:
NM_001346087.1
NBCI Gene record:
Mag (17136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094128 TGCTACACTTCGTGCCTACTA pLKO.1 846 CDS 100% 4.950 6.930 N Mag n/a
2 TRCN0000094126 CGTCATTTGTACCTCCAGGAA pLKO.1 1699 CDS 100% 2.640 2.112 N Mag n/a
3 TRCN0000244100 GTGTGGCTGAGAACCAGTATG pLKO_005 1419 CDS 100% 10.800 7.560 N MAG n/a
4 TRCN0000094124 GCTCCCTTTCTCTTGAGAGTA pLKO.1 2241 3UTR 100% 4.950 3.465 N Mag n/a
5 TRCN0000183999 CTTCAACCTGTCTGTGGAGTT pLKO.1 1456 CDS 100% 4.050 2.835 N MAG n/a
6 TRCN0000094127 CTGGTATTTCAATAGTCCCTA pLKO.1 418 CDS 100% 2.640 1.848 N Mag n/a
7 TRCN0000094125 GCAGTGTCTATGTGTGGTAAA pLKO.1 1528 CDS 100% 10.800 6.480 N Mag n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06550 pDONR223 100% 81.1% 86.2% None (many diffs) n/a
2 ccsbBroad304_06550 pLX_304 0% 81.1% 86.2% V5 (many diffs) n/a
3 TRCN0000478714 GTAAAGATAGCATCACTTCAATGT pLX_317 20.1% 81.1% 86.2% V5 (many diffs) n/a
Download CSV