Transcript: Human NM_001346091.2

Homo sapiens TNF receptor superfamily member 1A (TNFRSF1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFRSF1A (7132)
Length:
2017
CDS:
433..1476

Additional Resources:

NCBI RefSeq record:
NM_001346091.2
NBCI Gene record:
TNFRSF1A (7132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368663 AGAACCAGTACCGGCATTATT pLKO_005 494 CDS 100% 15.000 21.000 N TNFRSF1A n/a
2 TRCN0000058714 ACCGGCATTATTGGAGTGAAA pLKO.1 503 CDS 100% 4.950 6.930 N TNFRSF1A n/a
3 TRCN0000058713 CATTGGTTTAATGTATCGCTA pLKO.1 795 CDS 100% 2.640 3.696 N TNFRSF1A n/a
4 TRCN0000359596 CTTGAAGGAACTACTACTAAG pLKO_005 883 CDS 100% 10.800 8.640 N TNFRSF1A n/a
5 TRCN0000058716 GCTTGAAGGAACTACTACTAA pLKO.1 882 CDS 100% 5.625 4.500 N TNFRSF1A n/a
6 TRCN0000058715 TCCTGTAGTAACTGTAAGAAA pLKO.1 649 CDS 100% 5.625 4.500 N TNFRSF1A n/a
7 TRCN0000359597 TCCCTCCTCTTCATTGGTTTA pLKO_005 784 CDS 100% 10.800 7.560 N TNFRSF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01688 pDONR223 100% 76.2% 76.2% None 0_1ins324 n/a
2 ccsbBroad304_01688 pLX_304 0% 76.2% 76.2% V5 0_1ins324 n/a
3 TRCN0000492017 TTTAAGCCGTCGCCATTGCCCCCC pLX_317 26.2% 76.2% 76.2% V5 0_1ins324 n/a
4 TRCN0000489261 GGATAGATCTCTTAAATGATGGGA pLX_317 26.2% 76.2% 76% V5 0_1ins324;1041_1042insG n/a
5 TRCN0000488496 TATAGGGACCACTCGTGACGTACG pLX_317 26.1% 75.9% 76.2% V5 (not translated due to prior stop codon) 0_1ins324;1041_1042insTGAGC n/a
Download CSV