Transcript: Human NM_001346335.1

Homo sapiens autophagy related 13 (ATG13), transcript variant 31, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ATG13 (9776)
Length:
5840
CDS:
629..2155

Additional Resources:

NCBI RefSeq record:
NM_001346335.1
NBCI Gene record:
ATG13 (9776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415190 GGACCTTCTATCGGGAGTTTC pLKO_005 1992 CDS 100% 10.800 15.120 N ATG13 n/a
2 TRCN0000167734 GACCTGGACAAGTTTATTAAA pLKO.1 662 CDS 100% 15.000 10.500 N ATG13 n/a
3 TRCN0000423616 TGAAGTCCCTTCTTGCTATAA pLKO_005 1002 CDS 100% 13.200 9.240 N ATG13 n/a
4 TRCN0000172801 GCCATGTTTGCTCCCAAGAAT pLKO.1 1784 CDS 100% 5.625 3.938 N ATG13 n/a
5 TRCN0000172507 CCCACCTATGATCTGTCCTTT pLKO.1 3557 3UTR 100% 4.950 3.465 N ATG13 n/a
6 TRCN0000427008 GACCCAGAAGTCCCTACTCTT pLKO_005 2287 3UTR 100% 4.950 3.465 N ATG13 n/a
7 TRCN0000172704 GAGAAGAATGTCCGCGAGTTT pLKO.1 2108 CDS 100% 4.950 3.465 N ATG13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14028 pDONR223 100% 94.4% 93.8% None 786_869del;1514delA n/a
2 ccsbBroad304_14028 pLX_304 0% 94.4% 93.8% V5 (not translated due to frame shift) 786_869del;1514delA n/a
3 TRCN0000474634 TCTAACACTGCAATAGATTCCCGC pLX_317 36.4% 94.4% 93.8% V5 (not translated due to frame shift) 786_869del;1514delA n/a
4 ccsbBroadEn_15678 pDONR223 0% 78.5% 75.6% None (many diffs) n/a
5 ccsbBroad304_15678 pLX_304 0% 78.5% 75.6% V5 (many diffs) n/a
6 TRCN0000471230 TTAAGTCGTCACACAAGTTTCACA pLX_317 35.8% 78.5% 75.6% V5 (many diffs) n/a
Download CSV