Transcript: Human NM_001346397.2

Homo sapiens post-GPI attachment to proteins 2 (PGAP2), transcript variant 23, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
PGAP2 (27315)
Length:
1913
CDS:
83..1000

Additional Resources:

NCBI RefSeq record:
NM_001346397.2
NBCI Gene record:
PGAP2 (27315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425524 ACTTTCGGCACAACATGTATT pLKO_005 837 CDS 100% 13.200 18.480 N PGAP2 n/a
2 TRCN0000426168 GTCCTCAAACATCACCTTTAC pLKO_005 1194 3UTR 100% 10.800 8.640 N PGAP2 n/a
3 TRCN0000061454 GCGTTGCTAGTGCTCACTTAT pLKO.1 611 CDS 100% 13.200 9.240 N PGAP2 n/a
4 TRCN0000435086 TTCATAGGACTAATGTATTTC pLKO_005 1402 3UTR 100% 13.200 9.240 N PGAP2 n/a
5 TRCN0000412622 GAACAAGGAGCTGCTCATAAC pLKO_005 952 CDS 100% 10.800 7.560 N PGAP2 n/a
6 TRCN0000061456 CACTGTTGTCTTAACCAACAT pLKO.1 898 CDS 100% 0.495 0.347 N PGAP2 n/a
7 TRCN0000061453 CCATCCAGTTTCTGGCCTTTA pLKO.1 1297 3UTR 100% 10.800 6.480 N PGAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11863 pDONR223 100% 81.9% 81.9% None 1_153del;667_678del n/a
2 ccsbBroad304_11863 pLX_304 0% 81.9% 81.9% V5 1_153del;667_678del n/a
3 TRCN0000479879 CTTACCATCGGGAACAGGAACCTC pLX_317 46.6% 81.9% 81.9% V5 1_153del;667_678del n/a
Download CSV